Submitted: 20 Oct 2016
Revised: 26 Nov 2016
Accepted: 29 Jan 2017
First published online: 01 Feb 2017
EndNote EndNote

(Enw Format - Win & Mac)

BibTeX BibTeX

(Bib Format - Win & Mac)

Bookends Bookends

(Ris Format - Mac only)

EasyBib EasyBib

(Ris Format - Win & Mac)

Medlars Medlars

(Txt Format - Win & Mac)

Mendeley Web Mendeley Web
Mendeley Mendeley

(Ris Format - Win & Mac)

Papers Papers

(Ris Format - Win & Mac)

ProCite ProCite

(Ris Format - Win & Mac)

Reference Manager Reference Manager

(Ris Format - Win only)

Refworks Refworks

(Refworks Format - Win & Mac)

Zotero Zotero

(Ris Format - FireFox Plugin)

Abstract Page Views: 1720
PDF Downloads: 909
Full Text Views: 1599
Phylogenetic Grouping and Phenotypic Detection of Extended-Spectrum β-Lactamases Among <i>Escherichia coli</i> From Calves and Dairy Cows in Khuzestan, Iran

Int J Enteric Pathog, 5(1), 24-29; DOI:10.15171/ijep.2017.06

Research Article

Phylogenetic Grouping and Phenotypic Detection of Extended-Spectrum β-Lactamases Among Escherichia coli From Calves and Dairy Cows in Khuzestan, Iran

Mozhdeh Barzan1, Darioush Gharibi2,*, Masoud Ghorbanpoor3, Mohammadrahim Haji Hajikolaei4, Mehdi Pourmehdi-Boroujeni5

1 PhD Student of Bacteriology, Department of Pathobiology, Faculty of Veterinary Medicine, Shahid Chamran University of Ahvaz, Ahvaz, Iran
2 Assistant Professor, Department of Pathobiology, Faculty of Veterinary Medicine, Shahid Chamran University of Ahvaz, Ahvaz, Iran
3 Professor, Department of Pathobiology, Faculty of Veterinary Medicine, Shahid Chamran University of Ahvaz, Ahvaz, Iran
4 Professor, Department of Clinical Sciences, Faculty of Veterinary Medicine, Shahid Chamran University of Ahvaz, Ahvaz, Iran
5 Associate Professor, Department of Food Hygiene, Faculty of Veterinary Medicine, Shahid Chamran University of Ahvaz, Ahvaz, Iran

*Corresponding Author: Darioush Gharibi, Department of Pathobiology, Faculty of Veterinary Medicine, Shahid Chamran University of Ahvaz, P. O. Box: 6135714333, Ahvaz, Iran. Tel/Fax: +98-61-33360807; Email: dr.gharibi@gmail.com

Abstract

Background: Food-producing animals are under suspicion for the reservoir and colonization of ESBL (extended-spectrum beta-lactamase)-producing bacteria especially Enterobacteriaceae and therefore infection of the humans with them. The increasing reports on the ESBLs presence in the pathogenic and commensal Escherichia coli isolates have been a concern worldwide. These strains can be attributed to one of the main phylogenetic groups and subgroups. Several studies have shown the relationship between the phylogeny and antimicrobial resistance of E. coli strains.
Objectives: The aim of this study was to analyze the phylogenetic group of ESBL-producing E. coli and detect its phenotype using the multiplex polymerase chain reaction (PCR) and combined disk method.
Materials and Methods: Two hundred five E. coli fecal isolates were obtained from 103 calves (90 healthy and 13 diarrheic) and 102 dairy cows (healthy) from 8 farms in Khuzestan province, Iran. The triplex PCR method was used to allocate the E. coli isolates based on the presence or absence of 3 genes (chuA, yjaA, and tspE4.C2) to yield 4 definite phylogenetic groups and 7 subgroups. Phenotypic ESBL-producing E. coli was determined using the double disk diffusion method according to the manufacturer’s instructions and Clinical & Laboratory Standards Institute (CLSI) guidelines.
Results: A total of 65.04% and 22.3% of isolates from calves and 70.5% and 20.5% of isolates from dairy cows belonged to phylogroups B1 and A, respectively. In addition, no isolate from the diarrhoeic calves was found to belong to group B2 and subgroups D2 and A0. A low prevalence (2/205 isolates, 0.97%) of ESBL-producing E. coli was found only in the samples of dairy cows which belonged to the phylogenetic group A and phylogenetic subgroup A1. There was no statistically significant relationship between the phylogenetic group and the production of ESBLs (P = 0.11). There was also no difference between the E. coli isolates from calves and dairy cows in the production of ESBLs (P = 0.5).
Conclusion: There was no statistically significant relationship between the phylogenetic group and the production of ESBLs (P = 0.11). There was also no difference between E. coli isolates from calves and dairy cows in the production of ESBLs (P = 0.5). Based on these results, there is a low prevalence of ESBL-producing E. coli in the dairy farms of Khuzestan province. However, further large scale investigations are necessary to control the antibiotic resistance in the human and animal foodstuff.

Keywords: Escherichia coli, Phylogenetic groups, Extended-spectrum beta-lactamases (ESBLs), Calves, Dairy cows

Background

Escherichia coli strains are the major members of Enterobacteriaceae which are usually found in the digestive system of human and warm-blooded animals. Certain E. coli strains have been associated with neonatal diarrhea and extraintestinal infections in ruminants which cause appreciable economic losses in dairy industry all around the world.1,2 Phylogenetic analyses have shown that E. coli strains are located in 4 main phylogenetic groups (A, B1, B2, and D) and the strains differ in phenotypic characteristics including antibiotic-resistance patterns, and resistance to special antibiotics can be related to particular phylogenetic groups.3-6 The World Health Organization (WHO) reported that approximately 50% of the universally produced antibiotics are consumed for veterinary usages such as prophylactic and growth promotion purposes.7-9 The increase of antibiotic resistance following the use of antibiotics such as beta-lactams and growing the commensal and pathogenic ESBL (extended-spectrum beta-lactamase)-producing bacteria like E. coli strains especially in food-producing animals pose a threat to the public health and food safety.10-14 Researchers have suggested that the study of antibiotic resistance in commensal microorganisms like E. coli from the healthy animals would be quite useful, because they can be used as gnomon organisms to measure the prevalence of antibiotic resistance. These organisms could serve as a reservoir for the genes encoding antimicrobial resistance, which is transferred to the pathogenic bacteria or transmitted to the human by direct exposure to animals or via the food chain.15-19 It has been shown that the resistant bacteria with animal origin can either colonize or cause infection in humans.20

Objectives

Due to the importance and spread of ESBL-producing E. coli strains in the food-producing animals and possible relationship between the ESBL production and phylogenetic groups, the aim of this study was to evaluate the prevalence of ESBL-producing bacteria and the phylogenetic groups, on E. coli fecal isolates from calves and cows in dairy farms of Khuzestan province.

Materials and Methods

Sample Collection

A total of 237 fecal samples from healthy dairy cows (134 samples), healthy (90 samples) and diarrheic (13 samples) calves were aseptically collected from 8 dairy farms located in Khuzestan province, Iran. Samples were randomly obtained from the animals by recto-anal mucosal swab (RAMS) method and transported on ice to the microbiology laboratory. The samples were cultured on Mac Conkey agar and incubated at 37ºC for 24 hours. Three to 5 dark pink colonies (presumptive E. coli) were randomly selected and identified by subculturing on eosin methylene blue plate (EMB) and confirmed to be E. coli using the standard biochemical tests.21,22 The confirmed E. coli isolates were stored in skim milk at -70°C for further experiments.

DNA Extraction

DNA extraction from isolates was performed by boiling method as described previously.23 Briefly, a few colonies were suspended in 300 μL sterile distilled water and heated at 95°C for 10 minutes. Afterward, they were put on ice for 5 minutes. Then, they were centrifuged at 13 000 rpm for 10 minutes and the supernatant was used as the DNA template.

Phylogenetic Grouping by Multiplex Polymerase Chain Reaction

The triplex polymerase chain reaction (PCR) method was used to allocate the E. coli isolates based on the presence or absence of 3 genes (chuA, yjaA, and tspE4.C2) to yield 4 distinct phylogenetic groups (A, B1, B2, and D) and 7 subgroups (A0, A1, B1, B22, B23, D1, and D2) (Table 1).6,24 Multiplex PCR was achieved in a 25 μL reaction mixture, including master mix (12.5 μL, containing Tris-HCl pH 8.5, (NH4)2S04, 2mM MgCl2, 0.2% Tween 20, 0.4mM dNTPs, 0.2 units/μL Ampliqon Taq DNA polymerase and inert red dye) (Denmark), each primer (1 μL from 10μM) (Bioneer, South Korea), Distilled water (2.5 μL), and template DNA (4 μL). The primer pairs used for PCR amplification are shown in Table 2.6 A reaction with DNA of ECOR62 having chuA, yjaA, and Tspe4.C2 and a reaction without the template DNA was used as positive and negative controls, respectively. The PCR program was performed in a thermal cycler (Eppendorf, Germany) as follows: initial denaturation at 94°C for 5 minutes, 30 cycles of the 30 seconds at 94°C, 30 seconds at 55°C and 30 seconds at 72°C, followed by a final extension at 72°C for 7 minutes.6 Amplification products were separated on 1.5% agarose gel containing safe stain (Cinnagen, Iran).

Phenotypic Detection of ESBL in Escherichia coli Isolates

An initial screen test was done using ceftriaxone (30 μg) disk (Mast diagnostic, UK) with the Kirby-Bauer method advised by NCCLS (formerly known as the National Committee for Clinical Laboratory Standards). On the initial screen test, the isolates that showed a zone of inhibition ≤25 mm were then confirmed for ESBL production by the phenotypic confirmatory test. The ESBL phenotypic confirmatory test was determined by the double disk diffusion method including cefotaxime (30 μg)/cefotaxime-clavulanic acid (30 μg/10 μg) and ceftazidim (30 μg) /ceftazidime-clavulanic acid (30 μg/10 μg) (Mast Diagnostic, UK) on Mueller-Hinton agar (Merck, Germany) according to the manufacturer’s instructions and Clinical & Laboratory Standards Institute (CLSI) guidelines. The strains of E. coli (ATCC 25922) and Klebsiella pneumoniae (ATCC 700603) were respectively used as negative and positive controls in this study. The isolates were reported as ESBL-producing E. coli when a zone with increased diameter (≥5-mm) was observed for antimicrobial agent tested in combination with clavulanic acid compared to the zone diameter of the agent when tested alone.25

Statistical Analysis

Analyses of data were performed by SPSS software (version 16.0) and proportions were compared using the Fisher exact tests with the significance level set at P < 0.05.

Results

Out of a total of 237 fecal samples, 205 E. coli isolates were obtained from the calves and dairy cows and confirmed.

Phylogenetic grouping analyses showed that E. coli isolates were distributed among groups B1, A, D, and B2 with 67.8%, 21.4%, 6.8%, and 1.9% prevalence indexes, respectively. All phylogenetic groups and subgroups were observed among isolates but there was no isolate from the diarrheic calves belonging to the B2 group and A0 and D2 phylogenetic subgroups (Table 3). Furthermore, 4 isolates were remained untypable by Clermont method (Figure 1).

The results of initial screen test for the phenotypic detection of ESBL-producing E .coli strains showed that 35 isolates (20 isolates from cows and 15 isolates from calves) were ceftriaxone resistant. By the ESBL phenotypic confirmatory test, only 2 isolates from the dairy cows were confirmed for ESBL-producing E. coli (Table 4). All ESBL-producing isolates were found to belong to the phylogenetic group and subgroup A1. There was no statistically significant relationship between the phylogenetic group and the production of ESBLs (P = 0.11) and also no difference was observed between the calves and cows in the production of ESBLs (P = 0.5).

Table 1. Combination of chuA, yjaA, and TspE4.C2 Genes for Determination of Phylogenetic Subgroups of Escherichia coli22
Phylogenetic Subgroups Genes Combination Profile
A0 (chuA–, yjaA–, TspE4.C2–)
A1 (chuA–, yjaA+, TspE4.C2–)
B1 (chuA–, yjaA–, TspE4.C2+)
B22 (chuA+, yjaA+, TspE4.C2–)
B23 (chuA+, yjaA+, TspE4.C2+)
D1 (chuA+, yjaA–, TspE4.C2–)
D2 (chuA+, yjaA–, TspE4.C2+)
Untypeable (chuA–, yjaA+, TspE4.C2+)

Figure 1. Triplex PCR Profiles Specific for Escherichia coli Phylogenetic Groups and Subgroups.

Each combination of amplified chuA (279 bp), yjaA (211 bp), and TSPE4.C2 (152 bp) genes allowed the phylogenetic group and subgroup determination of a strain. Lane 1: Marker 100 bp (SinaClon); lane 2: negative control; lane 3: positive control; lane 4: phylogenetic group A (A0); lane 5: phylogenetic group A (A1); lane 6: phylogenetic group B1; lanes 7–8: phylogenetic group B2 (B22 and B23); lanes 9–10: phylogenetic group D (D1 and D2); and lane 11: untypable.

Table 2. The Primer Sequence of Genes for Determination of Escherichia coli Phylogenetic Groups6
Primer name Sequence (5´-3´) Target Gene Product Size (bp)
ChuA(F) GAC GAA CCA ACG GTC AGG AT chuA 279
ChuA(R) TGC CGC CAG TAC CAA AGA CA chuA 279
YjaA(F) TGAAGTGTCAGGAGACGCTG yjaA 211
YjaA(R) ATG GAG AAT GCG TTC CTC AAC yjaA 211
TspE4.c2(F) GAG TAA TGT CGG GGC ATT CA TspE4.c2 152
TspE4.c2(R) CGC GCC AAC AAA GTA TTA CG TspE4.c2 152

Discussion

Commensal E. coli derived from farm animals have genetic diversity and tracking them is of importance, as they are considered as hidden sources of resistant and virulent genes.26-29 The increasing o pathogenic and commensal ESBL-producing E. coli strains are originated from different sources (such as human, food, and animal) and the dissemination of antibiotic resistance among other members of Enterobacteriaceae is a worldwide problem in the control and treatment of infections in human and animals.30-34, Moreover, some studies have shown that infections caused by ESBL-producing bacteria leads to the increase in the economic costs of infections treatment and the morbidity and mortality of diseases.35 Furthermore, resistance to other antibiotic classes was observed in ESBL-producing E. coli more than non-ESBL-producing iso­lates.31,36 It has been shown that the intestinal pathogenic E. coli strains mainly belong to the phylogenetic groups A, B1, and D and the commensal strains belong to the groups A and B1, while extraintestinal pathogenic strains usually belong to the groups B2 and D. In our study, most of the isolates were found to belong to the phylogenetic groups B1 and A (A1). These results were almost similar to other studies which demonstrated that the isolates of phylogroup A were prevalent in the intestinal tracts of most animals24,37 and phylogroup B1 was dominant among isolates from healthy cattle.38

In accordance with the previous reports in Iran,23,39 this study showed that the phylogroup B1 was dominant in calves. The phylogroup B2 had also the least frequency, both in calves and dairy cows, and these outcomes confirmed the previous investigations.23 In contrast to a previous study1 that reported subgroup B23 as only present in the human and B2 especially B23 as a good index of human fecal pollution, our results showed that subgroup B23 was found among isolates from both calves (healthy) and dairy cows. Similarly, another study showed that E. coli isolates of ruminants (sheep, goat, calves, and cattle) and dogs belonged to the subgroup B23.23,40 Phylogenetic subgroups D2 and A0 and phylogroup B2 were not found among isolates from diarrheic calves and our results were similar to previous researches which showed that phylogenetic subgroups D2 and A0 and phylogroup B1 were not found among isolates from diarrhoeic calves.23 Though difficult to claim, the geographic variation, ecological conditions, environmental and health statuses play a significant role in E. coli phylogroup dispersion. Additionally, the prevalence of phylogenetic groups in animals is dependent on the body volume and host food diet.41

There are some reports on the ESBL-producing E. coli in sheep and poultry in Iran,42-44 however based on a search in the databases we could not find any data about ESBL-producing E. coli in calves and dairy cows in Khuzestan province. In this study, the prevalence of ESBL-producing E. coli and their association with the phylogroups of E. coli isolates from calves and dairy cows were considered. First, the ESBL-producing isolates were determined by the combined disk method and by PCR, and then the plenty and distribution of phylogenetic groups in E. coli isolates were investigated. Afterward, the relative frequencies of four phylogenetic groups of ESBL-producing E. coli populations were compared. A low prevalence (2/205 isolates, 0.97%) of ESBL-producing E. coli was found only in the cow samples which belonged to the phylogenetic group A and phylogenetic subgroup A1. Our results were in accordance with the results of Valat et al45 who reported that ESBL-producing E. coli isolates from cattle belonged mainly to the phylogroup A. The low prevalence of ESBL-producing E. coli was similar to the results of Shiraki et al,46 but it was very lower than that of some previous studies.47-52

Our results showed that there was no statistically significant relationship between the phylogenetic group and the production of ESBLs (P = 0.11). Previous studies showed that the use of antibiotics may strongly influence the phylogenetic group distribution of E. coli isolates.53 The resistance to different antibiotics was also particularly common for the phylogroups A and D and decreased in other groups.54 It is believed that alteration in antimicrobial agents’ resistance occurs more easily in the phylogenetic groups of E. coli strains except for B2.54 Such communication between the phylogenetic groups and the antibiotic resistance of strain could describe why farm mammals undergo antibiotic pressure. The strains of phylogenetic groups of A and B1 are selected and B2 strains counter-selected.

In conclusion, food-producing animals are under suspicion for the reservoir and colonization of ESBL-producing bacteria especially Enterobacteriaceae and therefore infection of the humans with them. Further large scale investigations are necessary to control the antibiotic resistance in the human and animal foodstuff.

Authors’ Contributions

Experiment design, experiment conduct, data interpretation and manuscript edition by DGH and MGH; sampling and study design by MHH; statistical analysis by MPB; literature review, laboratory performance and practice by MB.

Conflict of Interest Disclosures

The authors have declared that no conflict of interests exists.

Ethical Approval

We hereby declare that all ethical standards have been respected in the preparation of the article.

Financial Support

The research deputy of Shahid Chamran University supported the study.

Acknowledgments

The authors would like to acknowledge the research deputy of Shahid Chamran University for financial support.

References

  1. Carlos C, Pires MM, Stoppe NC, Hachich EM, Sato MIZ, Gomes TAT. Escherichia coli phylogenetic group determination and its application in the identification of the major animal source of fecal contamination. BMC Microbiol 2010;10:161. doi:10.1186/1471-2180-10-161. [Crossref]
  2. Shahrani M, Safarpoor Dehkordi F, Momtaz H. Characterization of Escherichia coli virulence genes, pathotypes and antibiotic resistance properties in diarrheic calves in Iran. Biol Res 2014;47:28. doi:10.1186/0717-6287-47-28. [Crossref]
  3. Kawamura-Sato K, Yoshida R, Shibayama K, Ohta M. Virulence genes, quinolones and fluoroquinolones resistance, and phylogenetic background of uropathogenic Escherichia coli Strains Isolatad in Japan. Jpn J Infect Dis 2010;63:113–115.
  4. Azeem Saeed M, Haque A, Ali A, Mohsin M, Bashir S, Tariq A. Relationship of drug resistance to phylogenetic groups of E. coli isolates from wound infections. J Infect Dev Ctries 2009;3(9):667–670.
  5. Bert F, Panhard X, Johnson J, Lecuyer H, Moreau R, Le Grand J. Genetic background of Escherichia coli isolates from patients with spontaneous bacterial peritonitis: relationship with host factors and prognosis. Clin Microbiol Infect 2008;14(11):1034–1040. doi:10.1111/j.1469-0691.2008.02088.x. [Crossref]
  6. Clermont O, Bonacorsi S, Bingen E. Rapid and simple determination of the Escherichia coli phylogenetic group. Appl Environ Microbiol 2000;66:4555–4558.
  7. World Health Organization (WHO). Use of antimicrobials outside human medicine and resultant antimicrobial resistance in humans. Fact sheet No. 194. http://www.who.int/mediacentre/factsheets/fs194/en/. Accessed September 2016.
  8. Aalipour F, Mirlohi M, Jalali M. Determination of antibiotic consumption index for animal originated foods produced in animal husbandry in Iran, 2010. J Environ Health Sci Eng 2014;12:42. doi:10.1186/2052-336X-12-42. [Crossref]
  9. Babapour A, Azami L, Fartashmehr J. Overview of antibiotic residues in Beef and Mutton in Ardebil, North West of Iran. World Appl Sci J 2012;19(10):1417–1422. doi:10.5829/idosi.wasj.2012.19.10.1802. [Crossref]
  10. Reist M, Geser N, Hächler H, Schärrer S, Stephan R. ESBL-producing Enterobacteriaceae: occurrence, risk factors for fecal carriage and strain traits in the Swiss slaughter cattle population younger than 2 years sampled at abattoir level. PLOS One 2013;8(8):717–725. doi:10.1371/journal.pone.0071725. [Crossref]
  11. Lee MH, Lee HJ, Ryo PD. Public health risks: chemical and antibiotic residues review. Asian-Australas. J Anim Sci 2000;14: 402-413. doi:10.5713/ajas.2001.402. [Crossref]
  12. Sawant AA, Hegde NV, Straley BA, Donaldson SC, Love BC, Knabel SJ. Antimicrobial-Resistant enteric bacteria from dairy cattle. Appl Environ Microbiol 2007;73(1):156–163. doi:10.1128/AEM.01551-06. [Crossref]
  13. Mokracka J, Jablonska L, Koczura R, Kaznowski A. Phylogenetic groups, virulence genes and quinolone resistance of integron-bearing Escherichia coli strains isolated from a wastewater treatment plant. Antonie Van Leeuwenhoek 2011;99:817–824. doi:10.1007/s10482-011-9555-4. [Crossref]
  14. Hammerum AM, Heuer OE, Emborg HD, et al. The Danish Integrated Antimicrobial Resistance Monitoring and Research Programme. Emerg Infect Dis 2007;13(11):1633–1639.
  15. Guillemot D, Courvalin P. Better control of antibiotic resistance. Clin Infect Dis 2001;33:542–547. doi:10.1086/322583. [Crossref]
  16. Levin BR, Lipsitch M, Perrot V, Schrag S, Antia R, Simonsen L. The population genetics of antibiotic resistance. Clin Infect Dis 1997;24:9–16.
  17. Aarestrup FM, Wegener HC, Collignon P. Resistance in bacteria of the food chain: epidemiology and control strategies. Expert Rev Anti-Infect Ther 2008;6:733–750. doi:10.1586/14787210.6.5.733. [Crossref]
  18. Fàbrega A, Sánchez-Céspedes J, Soto S, Vila J. Quinolone resistance in the food chain. Int J Antimicrob Agents 2008;31:307–315. doi:10.1016/j.ijantimicag.2007.12.010. [Crossref]
  19. Borjesson S, Egervarn M, Lindblad M, Englund S. Frequent occurrence of extended-spectrum beta-lactamase- and transferable ampc beta-lactamase-producing Escherichia coli on domestic chicken meat in Sweden. Appl Environ Microbiol 2013;79:2463–66. doi:10.1128/AEM.03893-12. [Crossref]
  20. Mesa RJ, Blanc V, Blanch AR, et al. Extended-spectrum b-lactamase producing Enterobacteriaceae in different environments (humans, food, animal farms and sewage). J Antimicrob Chemother 2006;58:211–215. doi:10.1093/jac/dkl211. [Crossref]
  21. Quinn PJ, Markey BK, Leonard FC, Fitz Patrick ES, Fanning S, Hortigan PJ. Veterinary Microbiology and Microbial Disease. 2nd ed. Chichester, West Sussex: Wiley-Blackwell; 2011.
  22. Bryan M, Finola L, Marie Ann C, Doris M. Clinical Veterinary Microbiology. 2nd ed. London: Mosby Elsevier; 2013:105-120.
  23. Barzan M, Rad M, Hashemi Tabar GR, Azizzadeh M. Phylogenetic analysis of Escherichia coli Isolates from healthy and diarrhoeic calves In Mashhad, Iran. Bulgarian Journal of Veterinary Medicine. 2016.
  24. Escobar-Páramo P, Le Menac’h A, Le Gall T, et al. Identification of forces shaping the commensal Escherichia coli genetic structure by comparing animal and human isolates. Environ Microbiol 2006;8:1975–1984. doi:10.1111/j.1462-2920.2006.01077.x. [Crossref]
  25. Clinical and Laboratory Standards Institute. Performance Standards for Antimicrobial Susceptibility Testing;Twenty-Fifth Informational Supplement (M100-S25). http://clsi.org/blog/2015/01/08/clsi-publishes-new-antimicrobial-susceptibility-testing-standards/. Published 2015.
  26. Leverstein-van Hall MA, Dierikx CM, Cohen Stuart J, Voets GM, van den Munckhof MP, van Essen-Zandbergen A. Dutch patients, retail chicken meat and poultry share the same ESBL genes, plasmids and strains. Clin Microbiol Infect 2011;17(6):873–880. doi:10.1111/j.1469-0691.2011.03497.x. [Crossref]
  27. Leistner R, Meyer E, Gastmeier P, Pfeifer Y, Eller C, Dem P. Risk factors associated with the community-acquired colonization of extended-spectrum beta-lactamase (ESBL) positive Escherichia coli. PLoS One 2013;8(9):74323. doi:10.1371/journal.pone.0074323. [Crossref]
  28. Antikainen J, Tarkka E, Haukka K, Siitonen A, Vaara M, Kirveskari J. New 16-plex PCR method for rapid detection of diarrheagenic Escherichia coli directly from stool samples. Eur J Clin Microbiol Infect Dis 2009;28:899-908. doi:10.1007/s10096-009-0720-x. [Crossref]
  29. Carattoli A. Animal reservoirs for extended spectrum betalactamase producers. Clin Microbiol Infect 2008;14:117–123. doi:10.1111/j.1469-0691.2007.01851.x. [Crossref]
  30. Pitout JD, Laupland KB. Extended-spectrum beta-lactamase-producing Enterobacteriaceae: an emerging public-health concern. Lancet Infect Dis 2008;8:159 –166.
  31. Coque TM, Baquero F, Canton R. Increasing prevalence of ESBL producing Enterobacteriaceae in Europe. Euro Surveill 2008;13:19051.
  32. Huijbers PM, De Kraker M, Graat EA, Van Hoek AH, Van Santen MG, De Jong MC. Prevalence of extended-spectrum beta-lactamase-producing Enterobacteriaceae in humans living in municipalities with high and low broiler density. Clin Microbiol Infect 2013;19:256–259. doi:10.1111/1469-0691.12150. [Crossref]
  33. Trott D. Beta-lactam resistance in gram-negative pathogens isolated from animals. Curr Pharm Des 2013;19:239–49.
  34. Mevius DJ, Koene MGJ, Wit B, Van Pelt W, Bondt N. Monitoring of antimicrobial resistance and antibiotic usage in animals in the Netherlands in 2010/2011. http://edepot.wur.nl/215472. Accessed 15 March 2013.
  35. Rupp ME, Fey PD. Extended spectrum beta-lactamase (ESBL)-producing Enterobacteriaceae: considerations fordiagnosis, prevention and drug treatment. Drugs 2003;63:353–365.
  36. Gniadkowski M. Evolution and epidemiology of extended-spectrum betalactamases (ESBLs) and ESBL-producing microorganisms. Clin Microbiol Infect 2001;7:597–608.
  37. Johnson JR, Kuskowski MA, Owens K, Gajewski A, Winokur PL. Phylogenetic origin and virulence genotype in relation to resistance to fluoroquinolones and/or extended-spectrum cephalosporins and cephamycins among Escherichia coli isolates from animals and humans. J Infect Dis 2003;188:759–768. doi:10.1086/377455. [Crossref]
  38. Asai KMT, Sato Ch, Hiki M, Usui M, Baba K, Ozawa M. Phylogenetic groups and cephalosporin resistance genes of Escherichia coli from diseased foodproducing animals in Japan. Acta Vet Scand 2011;53:52. doi:10.1186/1751-0147-53-52. [Crossref]
  39. Bihannic M, Ghanbarpour R, Auvray F, Cavalié L, Châtre P, Boury M. Identification and detection of three new F17 fimbrial variants in Escherichia coli strains isolated from cattle. Vet Res 2014;45:76. doi:10.1186/s13567-014-0076-9. [Crossref]
  40. Derakhshandeh A, Firouzi R, Naziri Z. Phylogenetic group determination of faecal Escherichia coli and comparative analysis among different hosts. IJVR 2014;15:13–17.
  41. Gordon DM, Cowling A. The distribution and genetic structure of Escherichia coli in Australian vertebrates: host and geographic effects. Microbiology 2003;149:3575–3586. doi:10.1099/mic.0.26486-0. [Crossref]
  42. Aliasadi S, Dastmalchi Saei H. Fecal carriage of Escherichia coli harboring extended-spectrum beta-lactamase (ESBL) genes by sheep and broilers in Urmia region, Iran. Iran. J Vet Med 2015;9(2):93–101.
  43. Jafari RA, Motamedi H, Maleki E, Ghanbarpour R, Mayahi M. Phylogenetic typing and detection of extended-spectrum β-lactamases in Escherichia coli isolates from broiler chickens in Ahvaz, Iran. Vet Res Forum 2016;7(3):227-233.
  44. Pourtaghi H, Sodagari HR. Antimicrobial resistance of entrotoxigenic and non-entrotoxigenic Escherichia coli isolated from diarrheic calves in Iran. Int J Enteric Pathog 2016;4(2):e34557. doi:10.17795/ijep34557. [Crossref]
  45. Valat CH, Auvray F, Forest K, Métayer V, Gay E, Peytavin de Garam C. Phylogenetic grouping and virulence potential of extended-spectrum-β-lactamase-producing Escherichia coli Strains in Cattle. Appl Environ Microbiol 2012;78(13):4677–4682. doi:10.1128/AEM.00351-12. [Crossref]
  46. Shiraki Y, Shibata N, Doi Y, Arakawa Y. Escherichia coli producing CTX-M-2 beta-lactamase in Cattle, Japan. Emerging Infect Dis 2004;10(1):69–75.
  47. Geser N, Stephan R, Hächler H. Occurrence and characteristics of extended spectrum b-lactamase (ESBL) producing Enterobacteriaceae in food producing animals, minced meat and raw milk. BMC Vet Res 2012;8:21. doi:10.1186/1746-6148-8-21. [Crossref]
  48. Geser N, Stephan R, Kuhnert P, et al. Fecal carriage of extended-spectrum b-lactamase–producing Enterobacteriaceae in Swine and Cattle at Slaughter in Switzerland. J Food Prot 2011;74(3):446–449. doi:10.4315/0362-028X.JFP-10-372. [Crossref]
  49. Tekiner IH, Özpınar H. Occurrence and characteristics of extended spectrum beta-lactamases-producing Enterobacteriaceae from foods of animal origin. Braz J Microbiol 2016;47:444–451. doi:10.1016/j.bjm.2015.11.034. [Crossref]
  50. Dahms K, Hübner NO, Kossow A, Mellmann A, Dittmann K, Kramer A. Occurrence of ESBL-producing Escherichia coli in Livestock and Farm Workers in Mecklenburg-Western Pomerania, Germany. PLOS One 2015;10(11):e0143326. doi:10.1371/journal.pone.014332. [Crossref]
  51. Olowe OA, Adewumi O, Odewale G, Ojurongbe O, Adefioye OJ. Phenotypic and molecular characterisation of extended-spectrum beta-lactamase producing Escherichia coli obtained from animal fecal samples in Ado Ekiti, Nigeria. J Environ Public Health 2015;2015:497980. doi:10.1155/2015/497980. [Crossref]
  52. Schmid A, Hormansdorfer S, Messelhausser U, Kasbohrer A, Sauter-Louis C, Mansfeld R. Prevalence of extended-spectrum beta-lactamase-producing Escherichia coli on Bavarian Dairy and Beef Cattle Farms. Appl Environ Microbiol 2013;79(9):3027–3032. doi:10.1128/AEM.00204-13. [Crossref]
  53. Wu G, Ehricht R, Mafura M. Escherichia coli isolates from extraintestinal organs of livestock animals harbour diverse virulence genes and belong to multiple genetic lineages. Vet Microbiol 2012;160:197–206. doi:10.1016/j.vetmic.2012.05.029. [Crossref]
  54. Bukh AS, Schønheyder HC, Emmersen JM, Søgaard M, Bastholm S, Roslev P. Escherichia coli phylogenetic groups are associated with site of infection and level of antibiotic resistance in community-acquired bacteraemia: a 10 year population-based study in Denmark. J Antimicrob Chemother 2009;64:163–168. doi:10.1093/jac/dkp156. [Crossref]