Submitted: 01 Oct 2016
Accepted: 09 Nov 2016
First published online: 15 Nov 2016
EndNote EndNote

(Enw Format - Win & Mac)

BibTeX BibTeX

(Bib Format - Win & Mac)

Bookends Bookends

(Ris Format - Mac only)

EasyBib EasyBib

(Ris Format - Win & Mac)

Medlars Medlars

(Txt Format - Win & Mac)

Mendeley Web Mendeley Web
Mendeley Mendeley

(Ris Format - Win & Mac)

Papers Papers

(Ris Format - Win & Mac)

ProCite ProCite

(Ris Format - Win & Mac)

Reference Manager Reference Manager

(Ris Format - Win only)

Refworks Refworks

(Refworks Format - Win & Mac)

Zotero Zotero

(Ris Format - FireFox Plugin)

Abstract Page Views: 627
PDF Downloads: 503
Full Text Views: 457
Association of selected human leukocyte antigen alleles (HLA-DQA1*0102, HLA-DQA1*0103 and HLA–DQB1*0301) with <em>Helicobacter pylori</em> infection among dyspeptic patients

Int J Enteric Pathog, 4(4), 2-37102; DOI:10.15171/ijep.2016.12

Original Article

Association of selected human leukocyte antigen alleles (HLA-DQA1*0102, HLA-DQA1*0103 and HLA–DQB1*0301) with Helicobacter pylori infection among dyspeptic patients

Piyumali Sandareka Arachchi1, Chinthika Prabhashinie Gunasekara1 ,*, Manjula Manoji Weerasekera1, Nushka Lahiri Ubhayawardana1, Deepaka Weerasekera2, Kamani Samarasinghe3, Bimalka Seneviratne3 ,*, Neluka Fernando1

1 Department of Microbiology, Faculty of Medical Sciences, University of Sri Jayewardenepura, Gangodawila, Nugegoda, Sri Lanka
2 Department of Surgery, Faculty of Medical Sciences, University of Sri Jayewardenepura, Gangodawila, Nugegoda, Sri Lanka;
3 Department of Pathology, Faculty of Medical Sciences, University of Sri Jayewardenepura, Gangodawila, Nugegoda, Sri Lanka;

*Corresponding Author: Dr. Chinthika Prabhashinie Gunasekara; Department of Microbiology, Faculty of Medical Sciences, University of Sri Jayewardenepura, Gangodawila, Nugegoda, Sri Lanka. Tel: +94718262860; Fax: +94112802026; Email: Seneviratne3

Abstract

Background: Helicobacter pylori has been identified as a group I carcinogenic bacterium that infects the gastric mucosa leading to gastritis, peptic ulcer disease, lymphoma, and gastric cancer. Pathogenesis of H. pylori depends on the virulence of the strain, host immune response, and modulating factors like smoking and diet.

Objectives: This study aimed to assess the association between selected human leukocyte antigen (HLA) alleles including HLA-DQA1*0102, HLA-DQA1*0103, and HLA-DQB1*0301, and the presence of H. pylori infection and disease severity among dyspeptic patients.

Materials and Methods: Gastric tissue samples were collected from 100 dyspeptic patients, who underwent upper gastrointestinal endoscopy at a tertiary care hospital. Presence of HLA alleles was confirmed using polymerase chain reaction (PCR). Helicobacter pylori infection was determined using PCR and Histology. The histological interpretation was done according to the ‘Sydney classification.’ Statistical analysis was done with SPSS version 22.

Results: Respective percentages of HLA-DQA1*0102, HLA-DQA1*0103, and HLA-DQB1*0301 were 39%, 31%, and 20%, respectively. Of the 25 samples positive for H. pylori infection, 56% (14/25), 36% (9/25), and 12% (3/25) were positive for HLA-DQA1*0102, HLA-DQA1*0103, and HLA-DQB1*0301 alleles respectively. Considering the association with H. pylori infection, only HLA-DQA1*0102 showed significant association (P = .044). No significant association was found between the HLA alleles and the histological severity among the H. pylori infected patients.

Conclusion: Investigation of immunogenetic factors contributing to susceptibility or resistance to H. pylori infection in Sri Lanka can provide an insight into understanding the risk of developing severe pathological complications among patients.

Keywords:: Helicobacter pylori, HLA-DQA1, HLA-DQB1, Polymerase chain reaction, Sri Lanka

Background

Helicobacter pylori is a bacterial pathogen which infects the gastric mucosa leading to gastritis, peptic ulcer disease, gastric cancer, and lymphoma.1 The outcome of Helicobacter infection depends on multiple factors including diversity of H. pylori strains, host or environmental factors, and duration of infection.2 Progression of the infection can lead to gastric atrophy, decreased gastric acid secretion, and gastric cancer.3

The human leukocyte antigen (HLA) class II encodes highly polymorphic cell surface molecules and is involved in antigen binding and presentation to T helper cells. The polymorphism of these HLA genes results in a diversity of immune responses of individuals to antigens, thereby making that individual more susceptible or resistant to infection.4 Immunogenetic analysis indicates a positive or negative association of HLA-DQ alleles with H. pylori infection, gastritis, and gastric cancer.5 The HLA allele frequency varies among different races and populations.6 Therefore, it is important to investigate the association of HLA alleles with H. pylori infection and development of gastric complications in a given population. In this study, we intended to investigate the association between selected HLA alleles and H. pylori infection among a group of dyspeptic patients in Sri Lanka.

Material and Methods

The study was a cross-sectional, descriptive study carried out among 100 dyspeptic patients who were required to undergo endoscopy at a tertiary care hospital. Two biopsy specimens were collected from antrum of each patient during endoscopy for further investigations. The samples were transported to the Department of Microbiology and the Department of Pathology in a state university in Sri Lanka.

Selection of Participants

Patients referred to the endoscopy unit at a tertiary care hospital for routine endoscopy procedure with symptoms of dyspepsia were recruited to the study. The selected patients were above 18 years of age and not taking antibiotics for two weeks prior to the endoscopy. Patients less than 18 years of age, mentally unstable patients, and those currently taking antibiotics were excluded from the study.

Histology of Biopsy Specimens

Biopsy specimens were subjected to histopathological examination for presence of H. pylori and the histological severity. Biopsy specimens were fixed with formalin and embedded in paraffin wax for preparation of 4-micron thick sections. Tissue sections were stained with hematoxylin and eosin and Giemsa stains as described previously.7 Specimens were examined by an investigator and severity was graded according to the updated Sydney system.8

Polymerase Chain Reaction and Human Leukocyte Antigen Genotyping

The second biopsy specimen was used for DNA extraction using the QIAamp DNA mini kit (Qiagen, Germany) following the manufacturer’s instructions. The presence of H. pylori was determined by polymerase chain reaction (PCR) using primers targeting glmM gene as described previously.9 PCR was carried out to identify the presence of HLA-DQA1*0102, HLA-DQA1*0103, and HLA-DQB1*0301 genes using PCR specific primers as described in Table 1.10

Table 1. Primer Sequences Used for the Identification of glmM, HLA-DQA1*0102, HLA -DQA1*0103, and HLA –DQB1*0301
Gene Primer Primer Sequence Product Size (bp) Refrences
glmM gene glmM-F AAGCTTTTAGGGGTGTTAGGGGTTT 294 6
glmM-R AAGCTTACTTTCTAACACTAACGC
HLA*-DQA1*0102 F CATGAATTTGATGGAGATGAGC 149 7
R ATGATGTTCAAGTTGTGTTTTGC
HLA*-DQA1*0103 F ACGGTCCCTCTGGCCAGTT 172 7
R ATGATGTTCAAGTTGTGTTTTGC
HLA*-DQB1*0301 F GACGGAGCGCGTGCGTTA 129 7
R CTGTTCCAGTACTCGGCGT

Abbreviation: HLA, human leukocyte antigen.

All PCR reactions were performed in 0.2 mL tubes using Flexigene thermal cycler (version 31.04). PCR for HLA-DQA1 genes was performed in a 50 µL reaction mixture consisting of 0.5X buffer (Go Taq Flexi DNA polymerase kit, Promega) with 2 mM MgCl2 (Go Taq Flexi DNA polymerase kit, Promega), 0.2 mM each of dATP, dCTP, dGTP and dTTP (Promega), 1 µM of each forward and reverse primers, 1.25 U of Go Taq Flexi DNA polymerase (Promega) and 2 µL of template. The PCR conditions mentioned in Ota et al, 1991, was followed with 5 minutes of initial denaturation at 94ºC, 35 cycles, and 7 minutes of final elongation at 72ºC.11

For the HLA-DQB1*0301, the PCR was performed in a 50 µL reaction mixture which consisted 1X buffer (Go Taq Flexi DNA polymerase kit, Promega) with 1.5 mM MgCl2 (Go Taq Flexi DNA polymerase kit, Promega), 0.2mM of each of dATP, dCTP, dGTP, and dTTP (Promega), 0.5 µM of forward and reverse primers, 1.25 U of Go Taq Flexi DNA polymerase (Promega), and 2 µL of template. Optimized PCR conditions were 94ºC for 5 minutes for initial denaturation, 35 cycles of 94ºC for 1 minutes, 55ºC for 1 minute and 72ºC for 2 minutes, and a final elongation step of 72ºC for 7 minutes.

The PCR products were visualized in 1.5% agarose gel and observed for the specific amplicons for HLA-DQA*0102 (149 bp), HLA-DQA1*0103 (172 bp), and HLA–DQB1*0301 (129 bp), respectively.

Statistical Analysis

Statistical analysis was done with SPSS version 22 (SPSS, Inc., Chicago, Illinois, USA) to determine the association of each selected HLA type with the H. pylori infection and severity of the disease, and chi-square test was used to determine the P value. The level of significance was set at P < .05.

Results

Out of 100 dyspeptic patients enrolled in the study, 65 were female while 35 were male. Most of the patients (68/100) were between 36-65 years of age. In this population, 81/100 (81%) had mild chronic gastritis while 13/100 (13%) had moderate chronic gastritis and 2/100 (2%) showed severe chronic gastritis on examination of the gastric biopsy. Other variables including atrophy, metaplasia, and dysplasia, evaluated under the modified Sydney criteria, were negative in all specimens.

Histological examination revealed the presence of H. pylori in 13 biopsy specimens while 22 patients were positive by PCR. A total of 25 patients were confirmed as H. pylori positive by either PCR or histology. A majority of patients (14/25, 56%) were in the 46-65 (55.5±9.5) age group. Among the H. pylori positive patients, 18/25 (72%), 5/25 (20%), and 2/25 (8%) had mild, moderate, and severe chronic gastritis, respectively. Considering the 25 positive samples, 56% of the infected were females. However, there was no significant association of H. pylori infection with gender (P = .276).

Genotype Frequency of HLA-DQA1 and HLA-DQB1 Alleles Among the Helicobacter pylori Positive and Negative Patients

The frequencies of alleles HLA-DQA1*0102, HLA-DQA1*0103, and HLA-DQB1*0301 were 39%, 31%, and 20% respectively out of the 100 biopsy specimens analyzed. Of these patients, 25 were positive for both HLA-DQA1*0102 and HLA–DQA1*0103 and 4 were positive for all 3 alleles.

Out of the 25 who were positive for H. pylori by either histology, PCR, or both, 56% (14/25) were positive for HLA-DQA1*0102, 36% (9/25) were positive for HLA–DQA1*0103, and 12% (3/25) for HLA–DQB10*0301 as described in Table 2. A significant association was seen between HLA-DQA1*0102 and H. pylori infection (P = .044) in this population while no significant association was seen for the other two alleles investigated (Table 2).

Table 2. Association of Selected HLA Alleles With Helicobacter pylori Infection
Allele Helicobacter pylori P Value Odds Ratio 95% CI
Positive (n = 25) Negative (n = 75)
HLA*-DQA1*0102 (n = 39) 14 25 0.044 2.545 1.010-6.414
HLA*-DQA1*0103 (n = 31) 9 22 0.533 1.355 0.521-3.525
HLA*-DQB1*0301 (n = 20) 3 17 0.248 0.465 0.124-1.745

Abbreviation: HLA, human leukocyte antigen.

Majority of the patients had mild chronic inflammation as shown in Table 3. No significant association between HLA alleles examined and the severity of the inflammation was observed among the H. pylori positive population.

Table 3. Association of HLA Alleles With Chronic Inflammation Among the Helicobacter pylori Positive Patients
Allele Severity of Inflammation Total (n = 25)
Mild Moderate Severe
HLA-DQA1*0102 44% (n = 11) 8% (n = 2) 4% (n = 1) 14
HLA-DQA1*0103 28% (n = 7) 4% (n = 1) 4% (n = 1) 9
HLA-DQB1*0301 12% (n = 3) - - 3
HLA-DQA1*0102 and HLA-DQA1*0103 28% (n = 7) 4% (n = 1) 4% (n = 1) 9
HLA-DQA1*0102 and HLA-DQB1*0301 8% (n = 2) - - 2
HLA-DQA1*0103 and HLA-DQB1*0301 4% (n = 1) - - 1
All three alleles 4% (n = 1) - - 1

Abbreviation: HLA, human leukocyte antigen.

Discussion

In this study we investigated the association between HLA alleles, HLA-DQA1*0102, HLA-DQA1*0103, and HLA–DQB1*0301, and H. pylori infection among a group of dyspeptic patients in Sri Lanka. The highest allele frequency was observed for HLA-DQA1*0102 in the current population and more than 50% of patients who were positive for H. pylori were also positive for this allele. The other two alleles did not have a significant association with H. pylori infection in this population.

The host genetic factors, namely HLA alleles, contributing to H. pylori infection has been studied by several groups. Studies done by Azuma et al12 and Magnusson et al13 suggest a decreased risk of H. pylori infection among Japanese and Swedish patients expressing HLA-DQA1*0102. Our results contrast with these studies as we observed a significant positive association of this allele with H. pylori infection among the Sri Lankan dyspeptic patient population. Reported studies by Santolaria et al14 and Kunstmann et al15 however was not able to determine any association of HLA-DQA1*0102 and H. pylori infection among Spanish and German populations. These differences reported may be due to the geographical variation in the allele distribution among the populations in various studies.

In the current study, no significant association of HLA–DQA1*0103 or HLA-DQB1*0301 with H. pylori infection was observed. Wang et al reported that HLA-DQA1*0103 and HLA-DQB1*0301 were associated with susceptibility to H. pylori infection among East Asian population while no such significant association was observed among the European population.16 The allele HLA-DQA1*0103 was suggested to be significantly increased in MALT lymphoma patients compared to non-ulcer dyspepsia patients who were either H. pylori positive or negative. After H. pylori eradication, in patients who carried HLA-DQA1*0103-DQB1*0601 the lymphomas regressed completely.17 However, in the current study no significant positive association could be found between H. pylori infection and HLA-DQA1*0103 allele.

The HLA-DQB1*0301 has been reported to be positively associated with gastric cancer with a decreased risk for H. pylori infection18 which suggested that the association of HLA-DQB1*0301 with gastric cancer was not through increased susceptibility to H. pylori infection. Still, controversy exists regarding HLA-DQB1*0301 allele, as several studies have shown that the presence of DQB1*0301 may have a protective role.6,19

In this study the majority of patients had mild chronic gastritis. H. pylori is known to induce an inflammatory immune response with infiltration of neutrophils and other inflammatory cells in the gastric mucosa. Inflammation and pathogenesis is further enhanced due to pathogen mediated generation of reactive oxygen and reactive nitrogen species.2,20 The severity of the gastric inflammation depends on several factors including the virulence of the bacterium, the host immune response, host genetic factors, and environmental factors.2 The bacterium has several mechanisms such as hypo-inflammatory lipopolysaccharides, and molecular mimicry,20 by which it can evade immune recognition and persist in the gastric epithelium with minimal pathology.

Previous studies indicate that the role of host genetic factors in determining the susceptibility to H. pylori infection varies among different countries. This can be due to not only the different distribution of HLA allele frequencies but also the other contributing factors such as diet, host genetic polymorphisms, and other environmental factors. Therefore, it is important to investigate the role of host genetic factors in different geographical locations to understand the risk factors for infection and disease progression in those populations. Out of the H. pylori infected patients, a majority had mild chronic inflammation regardless of the HLA allele. Therefore, it is possible that the selected HLA alleles do not play a major role in the severity of disease in this patient population.

Authors’ Contributions

Data acquisition, analysis, interpretation, drafting of the manuscript and statistical analysis was carried out by PSA and NLU. CPG, MMW, DW, KS, BSe and NF were responsible for the study concept and design, critical revision of the manuscript, administrative, technical and material support and study supervision.

Conflict of Interest Disclosures

Non.

Ethical Approval

Written informed consent was obtained from patients before sample collection and ethical approval for the study was obtained from the Ethical Review Committee of the University of Sri Jayewardenepura, Sri Lanka (No: 14/15).

Funding/Support

This study was supported by the National Science Foundation Research Scholarship (NSF/SCH/2015/04) and University of Sri Jayewardenepura Research Grants (ASP/06/RE/MED/2013/34 and ASP/01/RE/MED/2016/47).

Acknowledgments

This study was assisted by the staff at the Endoscopy Unit of the Colombo South Teaching Hospital, the staff at the Department of Pathology and Microbiology, Faculty of Medical Sciences, University of Sri Jayewardenepura, Sri Lanka.

References

  1. Kusters JG, Van Vliet AHM, Kuipers EJ. Pathogenesis of Helicobacter pylori infection. Clin Microbiol Rev 2006;19(3):449–490. doi:10.1128/cmr.00054-05. [Crossref]
  2. Atherton JC. The pathogenesis of Helicobacter pylori–induced gastro-duodenal diseases. Annu Rev Pathol Mech Dis 2006;1(1):63–96. doi:10.1146/annurev.pathol.1.110304.100125. [Crossref]
  3. Nguyen TN, Barkun AN, Fallone CA. Host determinants of Helicobacter pylori infection and its clinical outcome. Gastroenterology 1999;4(3):185-197.
  4. Zhao Y, Wang J, Tanaka T, et al. Association between HLA-DQ genotypes and haplotypes vs Helicobacter pylori infection in an indonesian population. Asian Pacific J Cancer Prev 2012;13:1247–1251. doi:10.7314/apjcp.2012.13.4.1247. [Crossref]
  5. Azizian R, Khosravi A, Azizian M. The association of the human leukocyte antigen (HLA) with the pathogenesis of Helicobacter pylori. J Pure Appl Microbiol 2013;7(3):2183–2189. doi:10.1111/j.1523-5378.2011.00876.x. [Crossref]
  6. Lee H-W, Hahm K-B, Lee JS, Ju Y-S, Lee KM, Lee KW. Association of the human leukocyte antigen class II alleles with chronic atrophic gastritis and gastric carcinoma in Koreans. J Dig Dis 2009;10(4):265–271. doi:10.1111/j.1751-2980.2009.00395.x. [Crossref]
  7. Suzuki RB, Lopes RAB, da Câmara Lopes GA, Hung Ho T, Sperança MA. Low Helicobacter pylori primary resistance to clarithromycin in gastric biopsy specimens from dyspeptic patients of a city in the interior of São Paulo, Brazil. BMC Gastroenterol 2013;13:164. doi:10.1186/1471-230x-13-164. [Crossref]
  8. Price AB. The Sydney System: histological division. J Gastroenterol Hepatol 1991;6:209–222.
  9. Ubhayawardana N, Weerasekera M, Weerasekera D, Samarasinghe K, Gunasekera C, Fernando N. Detection of clarithromycin-resistant Helicobacter pylori strains in a dyspeptic patient population in Sri Lanka by polymerase chain reaction-restriction fragment length polymorphism. Indian J Med Microbiol 2015;33(3):374–377.
  10. Olerup O, Aldener A, Fogdell A. HLA-DQBl and -DQAl typing by PCR amphfication with sequence-specific primers (PCR-SSP ) in 2 hours. Tissue Antigens 1993;41:119–134.
  11. Ota M, Seki T, Nomura N, et al. Modified PCR-RFLP method for HLA-DPB1 and -DQA1 genotyping. Tissue Antigens 1991;38:60–71.
  12. Azuma T, Ito S, Sato F, et al. The Role of the HLA-DQA1 Gene in Resistance to Atrophic Gastritis and Gastric Adenocarcinoma Induced by Helicobacter pylori Infection. Cancer 1998;82(6):1013–1118.
  13. Magnusson PKE, Enroth H, Eriksson I, Held M, Nyre O, Engstrand L. Gastric cancer and human leukocyte antigen: distinct DQ and DR alleles are associated with development of gastric cancer and infection by Helicobacter pylori. Cancer Res 2001;61:2684–2689.
  14. Santolaria S, Barrios Y, Benito R, Piazuelo E, Quintero E, Lanas a. Helicobacter pylori and immunogenetic factors of the host: relevance of the HLADQA1 *0102 and *0301 alleles in peptic ulcer. Gastroenterol Hepatol 2001;24(3):117–121.
  15. Kunstmann E, Hardt C, Treitz H, et al. In the European population HLA-class II genes are not associated with Helicobacter pylori infection. Eur J Gastroenterol Hepatol 2002;14(1):49–53.
  16. Wang J, Zhang Q, Liu Y, Han J, Ma X, Luo Y, et al. Association between HLA-II gene polymorphism and Helicobacter pylori infection in Asian and European population: a meta-analysis. Microb Pathog 2015;82:15–26. doi:10.1016/j.micpath.2015.03.011. [Crossref]
  17. Kawahara Y, Mizuno M, Yoshino T, et al. HLA-DQA1*0103-DQB1*0601 haplotype and Helicobacter pylori-positive gastric mucosa-associated lymphoid tissue lymphoma. Clin Gastroenterol Hepatol 2005;3(9):865–868.
  18. Lee JE, Lowy AM, Thompson WA, et al. Association of gastric adenocarcinoma with the HLA class II gene DQB1*0301. Gastroenterology 1996;111:426–432.
  19. Wu MS, Hsieh RP, Huang SP, et al. Association of HLA-DQB1*0301 and HLA-DQB1*0602 with different subtypes of Gastric Cancer in Taiwan. JPN J Cancer Res 2002;93:404–410.
  20. Testerman TL, Morris J. Beyond the stomach: an updated view of Helicobacter pylori pathogenesis, diagnosis, and treatment. World J Gastroenterol 2014;20(36):12781–1808. doi:10.3748/wjg.v20.i36.12781. [Crossref]