Submitted: 01 Oct 2016
Accepted: 01 Oct 2016
First published online: 15 Nov 2016
EndNote EndNote

(Enw Format - Win & Mac)

BibTeX BibTeX

(Bib Format - Win & Mac)

Bookends Bookends

(Ris Format - Mac only)

EasyBib EasyBib

(Ris Format - Win & Mac)

Medlars Medlars

(Txt Format - Win & Mac)

Mendeley Web Mendeley Web
Mendeley Mendeley

(Ris Format - Win & Mac)

Papers Papers

(Ris Format - Win & Mac)

ProCite ProCite

(Ris Format - Win & Mac)

Reference Manager Reference Manager

(Ris Format - Win only)

Refworks Refworks

(Refworks Format - Win & Mac)

Zotero Zotero

(Ris Format - FireFox Plugin)

Abstract Page Views: 1489
PDF Downloads: 1035
Full Text Views: 1273
Evaluation of Colicin Effect on the Induction of Treated Mice in Prevention of Infection Caused by <em>Escherichia coli</em> K99

Int J Enteric Pathog, 4(4), 6-37106; DOI:10.15171/ijep.2016.16

Original Article

Evaluation of Colicin Effect on the Induction of Treated Mice in Prevention of Infection Caused by Escherichia coli K99

Yahya Tahamtan1 ,*, Fatemeh Golestan2, Elham Moazamian3

1 Bacteriology Department, Razi Vaccine and Serum Research Institute, Shiraz Branch, Iran
2 Microbiology Department, Azad University of Jahrom, Jahrom, Iran
3 Microbiology Department, Azad University of Shiraz, Shiraz, Iran

*Corresponding author: YahyaTahamtan, Razi Vaccine and Serum Research Institute, Shiraz, Iran. Phone: +987136240331, Fax: +987136240201, Email: yahyatahamtan@yahoo.com, Email: y.tahamtan@rvsri.ac.ir

Abstract

Background. Colicins produced by colicinogenic Escherichia coli (CEC) are narrow-spectrum antimicrobial agents that are able to kill or prevent closely related strains.

Objectives: The objective of this study was to evaluate the effect of Colicin on the induction of treated mice in prevention of infection caused by E. coli K99.

Materials and Methods: The experiment was conducted on 2 mice groups of 2-week-old (30 in each group). All mice were administered streptomycin sulfate prior to treatment to eliminate resident E. coli. Group 1 was orally inoculated with phosphate buffer saline (PBS) as control and the second was fed with colicin solution as treated group. Both control and treated groups were challenged by 3 LD50 of E. coli K99 and followed up for 1 week.

Results. Treated mice did not show severe clinical signs. While diarrhea with different sings of colibacillosis was established in control group, infected mice showed different clinical signs.

Conclusion: The study indicates that the use of colicin and biotherapy instead of antibiotic may be more safe and efficient for control of E. coli K99 infection. Treated mice by colicin solution protected E. coli K99 colonization and reduced fecal shedding. Investigation on livestock for applying colicin in animal farms is recommended.


Keywords: mice, Colicin, colibacillosis, Protection

Background

The neonatal calf, pig, lamb, and kid are mostly involved with many diarrheal diseases.1 Epidemiologic studies have indicated enterotoxigenic Escherichia coli (ETEC) K99 as the major cause of neonatal diarrhea occurring in the first four days of life.2 The disease has been estimated to be responsible for as much as 30% of the economic losses in animal husbandry.3 The use of antibiotics for diarrheal diseases has been blamed for the emergence of multidrug resistance in food animals and human medicine.4,5 The high risk of antimicrobial resistance and increasing antibiotic residues in environment have compelled to look for alternative antibiotics.4,6 The potential use of bacteriocin-producing bacteria as probiotic and bio-protective agents has recently received increasing attention.7,8 Colicins are narrow-spectrum bacteriocins produced by colicinogenic E. coli (CEC) that are toxic only to bacteria closely related to the producing strain.9 They are produced by strains of E. coli that carry a colicinogenic plasmid, bearing the genetic determinant for colicin synthesis, immunity, and release.3,5 Surveys have shown that approximately 30% of all E. coli strains can produce colicin.10 Pore-forming colicin, such as colicin V (ColV), binds to its target bacteria, disrupts the ionic gradient of the cell, and then kills it.5

Although many studies have investigated the inhibitory effect of colicin against intestinal E. coli pathogen,8,10,11 none of them has explained an experimental in vivo study against E. coli K99. However, the study of interaction between pathogenic bacteria and the host needs a simple and cheap animal model.

Objectives

In this research, we investigated the effect of ColV for protection of mice against pathogenic E. coli K99 strain.

Patients and Methods

Bacteria

Escherichia coli K99 and CEC isolated from cattle gastrointestinal (GI) tract were previously collected and stored at -70°C.12,13 Virulence factors and colicin gene of the strains were verified by polymerase chain reaction (PCR). The strains were revived and inoculated onto the trypticase soy broth (TSB) (HiMedia, India). DNA extraction was carried out by commercial extraction kit (DNA kit Cina-Gene, Iran). Four sets of primers were used for amplification of genes (Table 1).14,15 A volume of 25 µL PCR mixture was applied for amplification of these genes. PCR mixture included: a 25 µL reaction volume containing 10 × PCR buffer (2.5 µL), 25mM MgCl2, dNTP (10mM), forward and reverse primers (20 pmol), DNA template (100 ng), distilled water (18.5 µL), and Taq DNA polymerase (O.25 µL) (all from Fermentas, Germany). The PCR procedure was performed by Master Gradient Termocycler (Eppendorf, Germany) at 94°C for 3 minutes (one cycle for initial denaturation), 94°C for 30 seconds (denaturation), 56°C for 35 seconds (annealing), and 70°C for 45 seconds (extension), followed by 72°C for 10 minutes (final extension). The stages 2, 3, and 4 were repeated for 25 cycles. The PCR product was stained by etidium bromide, electrophoresed, run on agarose gel, and finally visualized under ultra violet by gel documentation system (Gel Doc, KodaK, USA).

Table 1. Oligoneucleotide Primers Used in Multiplex PCR
Gene Oligonucleotide Primer Size of Product (bp)
F5 TATTATCTTAGGTGGTATGG
GGTATCCTTTAGCAGCAGTATTTC
314
F41 GCATCAGCGGCAGTATCT
GTCCCTAGCTCAGTATTATCACCT
380
STa GCTAATGTTGGCAATTTTTATTTCTGTA
AGGATTACAACAAAGTTCACAGCAGTAA
190
Col V CAC GCC CTG AAG CAC CAC CA
CCG TTT TCC AAG CGG ACC CC
400

Escherichia coli K99 Preparation

The E. coli k99 was grown in Minca broth medium and incubated overnight (O/N) at 37°C. Cells were washed with phosphate buffer saline (PBS) (Kimiateb Co., Iran) by centrifugation at 3000×g for 4 minutes and the number of bacteria was adjusted to 1×108 CFU/mL.

Colicin Solution Preparation

The method of Pugsley and Oudega,16 with some modifications, was used to prepare colicin solution. Briefly, CEC strains were grown in Luria-Bertani (LB) (HiMedia, India) broth and incubated O/N at 37ºC. Five milliliters of the O/N culture was inoculated into 50 mL of fresh LB broth and incubated at 37°C for 3 to 4 hours with shaking (160 rpm). When the optical density at 600 nm reached 0.4, mitomycin C solution (250 µg/mL) was added to attain a volume of 500 ng/mLat final concentration (mitomycin induces Colicin production). After 1 hour additional incubation, the broth was disrupted by sonication (UP200H; Hielscher Co. Germany), then centrifuged, and the supernatant was filtrated through low protein-binding 0.22-µm-pore-size membrane filters (Spritzenfilter, Denmark) and stored at -80°C as colicin solution. The production of colicin was proved in previous experiment, before we examine the antibacterial effect of some colicinogenic E. coli by Spot method.

Mice Treatment

The experiment was conducted on 2 mice groups of 2-week-old (30 in each group). Prior to bacterial inoculation, all mice were administered 10mg/Lstreptomycin sulfate (Jaber-E-BneHayyan Pharmaceutical Mfg. Co., Iran) in their drinking water to eliminate resident E. coli facultative bacteria. Antibiotic treated mice were screened for considering fecal E. coli by plating on eosin methylene blue (EMB) agar (HiMedia, India) plates. The mice were divided equally into 2 groups. The first group was maintained in a separate cage as control inoculated with oral PBS. All mice in the second group were fed with colicin solution twice a day, with 2-day intervals.

Treated Mice Comparison

Pathogenic E. coli K99 was used for challenge. The LD50 was estimated according to Yousif et al.17 Both control and treated groups were challenged by 3 LD50 of E. coli K99 and followed up for 1 week. Fecal samples from both groups were taken 7 days after challenge. One gram of feces was separately transferred onto 1 mL of PBS. They were serially diluted tenfold (1:10) in PBS (pH 7.2), 200 µL of each dilution was plated onto nutrient agar, and the plates were incubated for 24 hours at 37°C. Colony forming units (CFUs) were monitored per gram feces.

Data Analysis

The results were declared as means ± standard deviation (SD). Analysis of variance (ANOVA) was used to distinguish statistical significant differences (P < .05) among various groups. A 2-tailed, paired Student’s t test was carried out to characterize statistical variation between groups.

Results

Bacterial Detection

PCR was used for determination of the genes encoding the colicins for CEC and virulence factors for E. coli K99. Multiplex PCR identified 2 fimbrial (F 5 and F 41) and one STa toxin genes of E. coli K99 and CEC harbored Col V (Figure 1).

Figure 1. Product of Multiplex PCR on E. coli K99 Isolated From Cattle.

Line M: 100 bp ladder, C-: negative control, F41fimbria: 380 bp, K99fimbria: 314, heat stable enterotoxin190 and ColV of colicinogenic E. coli: 400 bp.

Experimental Challenge

Treated mice group showed mild signs of illness and depression for 2-3 days including loss of appetite and weight, dehydration, ruffled fur, lethargy, and hunched posture. Diarrhea may or may not be seen. They went back to normal condition at the middle of the experiment (4 days after the experiment was started). As noted, E. coli k99 was established in GI tract of control group and watery diarrhea was observed with different sings of colibacillosis post challenge. The infected mice could be fatal if not treated within 3-4 days (Figure 2).

Figure 2. Number of Alive and Dead Mice in Treated and Control Challenge.

Colony Count

The excretion rate of E. coli K99 in control and treated mice groups are shown in Table 2. The levels of E. coli K99 recovered in the feces of treated group was significantly lower than those in the feces of control group (P < .05). However, except for a difference observed at day 1 (less than 1.2 log10 CFU g-1), none of these differences were statistically significant. There were observed significant differences between 2 groups after day 4 (where the differences were more than 1.2 log10 CFU g-1) (P < .05). A maximum of 1.262 log10 CFU g-1 reduction in E. coli K99 was obtained 5 days after colicin solution intake (P < .05).

Table 2. Fecal Shedding of Escherichia coli K99 by Adult Mice During 7 Days of Experiment
E. coli K99 Count (log10 CFU g-1)
Day Control Group (n = 30) Treated Group (n = 30) diff3 P
1 2 3 4 5 6 7 8 Ave1 1 2 3 4 5 6 7 8 Ave
1 5.6 5.4 5.5 5.3 5.7 5.2 6.1 5.3 5.513±0.29a 4.9 4.4 5 4.5 4.9 4.8 5 4.9 4.8±0.227a 0.713 .0439
2 4.3 4.6 4.2 4.5 4.7 4.1 4.4 4 4.35±0.245 3.7 3.4 3.6 3.3 3.5 3.6 3.3 3.4 3.475±0.149 0.875 .0709
3 4.1 4 3.9 3.6 3.7 3.8 3.5 3.6 3.775±0.212 3.9 3.6 3.8 3.1 3.4 3.2 3.1 3 3.388±0.344 0.387 .0467
4 3.3 3.7 3.4 3.3 3.6 3.5 3.8 3.2 3.475±0.212b 3 2.6 2.7 2.1 1.9 1.8e 2.2 2.3 2.325±0.413b 1.42 .0038
5 3.2 3 3.1 2.9 3.3 2.8 2.9 2.9 3.012±0.173c 2.2 2.1 2 1.8 1.7 1.5 1.4 1.3 1.75±0.334c 1.26 .0041
6 2.7 2.5l 2.6 2.4 2.8 2.6 2.4 2.2 2.525±0.191d 1.5 1.3 1.7 1.1 1.2 1.2 1 1 1.25±0.245d 1.27 .0084
7 2 1 1.3 1.7 1.2 1.4 1.6 1.8 1.5±0.334 1 0.6 0.8 0.7 0.6 0.5 0.4 0.3 0.613±0.223 0.887 .253
D2 - + + + - + + + + - - + - - - - - -

Variables with P < .05, in different alphabetical letters, are considered significant.

1Average; 2Diarrhea; 3Differences (diff) between the mean of control group and treated group in each day.

Discussion

We examined the efficacy of ColV in preventing diarrhea caused by E. coli K99. Treated mice with colicin solution prevented colonization of E. coli K99 in GI tract. An in vitro previous study by Shirazi et al proposed that colicin production by CEC is responsible for the inhibition of E. coli k99. Using Spot method, we showed colicin inhibited the growth of E. coli K99.12 The finding of Shirazi et al was comparable with the results of the present study, in which ColV could abrogate lethal activity of E. coli K99 in mice.

The use of CEC9 to colonize in the GI tracts of lamb and kid who suffer from clinical diarrhea is currently considered . Some experiments revealed that colicin removed E. coli from GI tract and inhibited the growth of E. coli K88, the causative agent of swine diarrhea.18 Lema et al fed lambs with a mixture of CEC to reduce the incidence of diarrhea, and observed a decrease in pathogen levels.19 The results indicated that oral administration of E. coli K99 after colicin inoculums is more effective than vice versa. This might refer to competitive aspect of CEC. Colicin was primarily replaced in infant GI tract, all receptor binding sites were blocked, and thereafter, E. coli K99 attachment was inhibited.9

The differences between control and test groups in fecal shedding was 1.2 and 1.4 log CFU g-1 feces after days 4 and 5, respectively. These differences among other studies were varied, as 1.75, 1.52, 1.6, and 1.8 log10 CFU g-1 feces per days 16, 18, 21, and 18, respectively.10 The mechanism of action of CEC in the inhibition of E. coli K99 was not fully understood. It seems that the competitive inhibition of pathogenic bacteria from adhering to respective host receptors, production of anti-bacterial substances such as colicin, and probiotic diversity should be the inhibitory mechanisms of CEC in deterrence of E. coli K99 colonization.20 The rate of the colicin solution that reached the GI tract may have been the ascertaining factor in the appearance of diarrhea.12

Colicin significantly decreased the fecal shedding level of the E. coli K99 at early hours post challenge. Not all E. coli K99 would be killed by colicin solution; in fact, fewer of the E. coli K99 was able to cause inflammatory response and produce diarrhea in the treated mice group. Fairbrother et al21 and Gyles22 verified this may be due to the low expression of interleukin-1β (IL-1β) in the GI tract tissue treated with colicin solution. During the inflammatory response, IL-1β is firstly secreted by macrophages and active lymphocytes. IL-1β release has been associated with E. coli K99 toxin production. Girard et al23 demonstrated in high dose of colicin intake, the concentration of IL-1β in GI tract was significantly decreased. They also indicated low-dose colicin solution increased IL-1β levels to over six-fold, higher than those in the control group.

In conclusion, this result indicated the potential use of CEC to protect colonization of E. coli K99 in GI tract of murine model and reduce fecal shedding and therefore prevent diarrhea. Colicin and biotherapy are good alternative antibacterial agents instead of antibiotic. Investigation on livestock for applying colicin in animal farms is recommended.

Authors’ Contributions

FG: preparing the manuscript and laboratory practice. YT: Study design, English editing of the manuscript and Literature review.

Conflict of Interest Disclosures

None.

Ethical Appproval

The institutional review board approved the study.

Funding/Support

This study was financially supported with grant number: 2-84-18-87064.

Acknowledgments

We thank Dr M H Hosseini, Dr M Kargar, Dr O R Amrabadi, and all of the people who collaborated with the authors, particularly the Veterinary Organization of Fars province, Iran.

References

  1. Kawakami S, Yamada T, Nakanishi N, Cai Y. Feeding of lactic acid bacteria and yeast on growth and diarrhea of Holstein calves. J Anim Vet Adv 2010;9(7):1112-1114.
  2. Foster DM, Smith GW. Pathophysiology of diarrhea in calves. Vet Clin North Am Food Anim Pract 2009;25(1):13-36. doi:10.1016/j.cvfa.2008.10.013. [Crossref]
  3. Barnes B, Sidhu H, Gordon DM. Host gastro-intestinal dynamics and the frequency of colicin production by Escherichia coli. Microbiology 2007;153:2823–2827. doi:10.1099/mic.0.2007/007120-0. [Crossref]
  4. Amezcua R, Friendship RM, Dewey CE, Gyles C, Fairbrother JM. Presentation of postweaning Escherichia coli diarrhea in southern Ontario prevalence of hemolytic E. coli serogroups involved and their antimicrobial resistance patterns. Can J Vet Res 2002;66:73-78.
  5. Cascales E, Buchanan SK, Duche D, et al. Colicin biology. Microbiol Mol Biol Rev 2007;71:158–229. doi:10.1128/mmbr.00036-06. [Crossref]
  6. Nagy B, Fekete PZ. Enterotoxigenic Escherichia coli in veterinary medicine. Int J Med Microbiol 2005;295:443-454. doi:10.1016/j.ijmm.2005.07.003. [Crossref]
  7. Gillor O, Etzion A, Riley MA. The dual role of bacteriocins as anti- and probiotics. Appl Microbiol Biotechnol 2008;81(4):591–606. doi:10.1007/s00253-008-1726-5. [Crossref]
  8. Setia A, Bhandari SK, House JD, Nyachoti CM, Krause DO. Development and in vitro evaluation of an Escherichia coli probiotic able to inhibit the growth of pathogenic Escherichia coli K88. J Anim Sci 2009;87:2005-2012. doi:10.2527/jas.2008-1400. [Crossref]
  9. Riley MA, Wertz JE. Bacteriocins: evolution, ecology, and application. Annual Reveiw of Microbiology 2002;56:117-137. doi:10.1146/annurev.micro.56.012302.161024. [Crossref]
  10. Schamberger GP, Phillips RL, Jacobs JL. Reduction of Escherichia coli O157: H7 populations in cattle by addition of colicin E7 producing E. coli to feed. Appl Environ Microbioly 2004;70:6053-6060. doi:10.1128/aem.70.10.6053-6060.2004. [Crossref]
  11. Mirnejad R, Jafari H, Ardebilli A, Babavalian H. Reduction of enterotoxigenic Escherichia coli colonization by the oral administration of Lactobacillus casei as a probiotic in a murine model. Afr J Microbiol Res 2010;4:2283-7.
  12. Shirazi Z, Tahamtan Y, Hayati M, Sahragard I. Inhibition of colicinogenic E. coli on diarrheic E. coli K99 isolated from calves. Online Journal of Veterinary Research 2013;17:236-244.
  13. Shams Z, Tahamtan Y, Pourbakhsh A, Hosseiny MH, Kargar M, Hayati M. Detection of enterotoxigenic K99 (F5,F41) from fecal sample of calves by molecular and serological methods. Comprative Clinical Pathology 2010;2:123-126. doi:10.1007/s00580-010-1122-2. [Crossref]
  14. Hall TA. BioEdit: A user-friendly biological sequence alignment editor and analysis program for windows 95/98/NT. http://www.mbio.ncsu.edu/bioedit/bioedit.html.
  15. Benson DA, Karsch-Mizrachi I, Lipman DJ, Ostell J, Wheeler DL. GenBank. Nucleic Acids Res 2006;34:16–20.
  16. Pugsley AP, Oudega B. Methods for studying colicins and their plasmids, P. 105-161. In: Hardy KG, ed. Plasmids: A Practical Approach. Oxford, United kingdom: IRL press; 1987.
  17. Yousif AA, Mahmood NM, Al-Taai NA. Immunization of mice with killed E. coli K99 vaccine for protection against colibaccillosis. Int J Microbiol Res 2013;5:482-485. doi:10.9735/0975-5276.5.6.482-485. [Crossref]
  18. Stahl CH, Callaway TR, Lincoln LM, Lonergan SM, Genovese KJ. Inhibitory activities of colicins against Escherichia coli strains responsible for postweaning diarrhoea and edema disease in swine. Antimicrob Agents Chemother 2004;48:3119–3121. doi:10.1128/aac.48.8.3119-3121.2004. [Crossref]
  19. Lema M, Williams L, Rao DR. Reduction of fecal shedding of enterohemorrhagic Escherichia coli O157:H7 in lambs by feeding microbial feed supplement. Small Rumin Res 2001;39:31-39.
  20. Cutler SA, Lonergan SM, Cornick N, Johnson AK, Stahl CH. Dietary inclusion of colicin E1 is effective in preventing postweaning diarrhea caused by F18-positive Escherichia coli in pigs. Antimicrob Agents Chemother 2007;51:3830-3835.
  21. Fairbrother JM, Nadeau E, Gyles CL. Escherichia coli in postweaning diarrhea in pigs: an update on bacterial types, pathogenesis, and prevention strategies. Anim Health Res Rev 2005;6(1):17-39.
  22. Gyles CL. Shiga toxin-producing Escherichia coli: an overview. J Anim Sci 2006;85:E45-E62. doi:10.2527/jas.2006-508. [Crossref]
  23. Girard F, Batisson I, Frankel GM, Harel J, Fairbrother JM. Interaction of enteropathogenic and Shiga toxin-producing Escherichia coli and porcine intestinal mucosa: role of intimin and Tir in adherence. Infection and Immunity 2005;73:6005-6016. doi:10.1128/iai.73.9.6005-6016.2005. [Crossref]