Submitted: 21 Dec 2015
Revised: 02 Feb 2016
Accepted: 09 Mar 2016
First published online: 16 Apr 2016
EndNote EndNote

(Enw Format - Win & Mac)

BibTeX BibTeX

(Bib Format - Win & Mac)

Bookends Bookends

(Ris Format - Mac only)

EasyBib EasyBib

(Ris Format - Win & Mac)

Medlars Medlars

(Txt Format - Win & Mac)

Mendeley Web Mendeley Web
Mendeley Mendeley

(Ris Format - Win & Mac)

Papers Papers

(Ris Format - Win & Mac)

ProCite ProCite

(Ris Format - Win & Mac)

Reference Manager Reference Manager

(Ris Format - Win only)

Refworks Refworks

(Refworks Format - Win & Mac)

Zotero Zotero

(Ris Format - FireFox Plugin)

Abstract Page Views: 468
PDF Downloads: 488
Full Text Views: 340
The Prevalence of netB Gene in Isolated <em>Clostridium perfringens</em> From Organic Broiler Farms Suspected to Necrotic Enteritis

Int J Enteric Pathog, 4(3), 3-35667; DOI:10.15171/ijep.2016.03

Original Article

The Prevalence of netB Gene in Isolated Clostridium perfringens From Organic Broiler Farms Suspected to Necrotic Enteritis

Majid Ezatkhah1, Mojtaba Alimolaei1 ,*, Neda Shahdadnejad2

1 Department of Molecular Microbiology, Kerman Branch, Razi Vaccine and Serum Research Institute, Agricultural Research, Education and Extension Organization (AREEO), Kerman, Iran
2 Department of Animal Science, Shahid Bahonar University of Kerman, Kerman, Iran

*Corresponding Author: Mojtaba Alimolaei, Tel: +98-9133971693; Fax: +98-3432472336; Email: m.alimolaei@rvsri.ac.ir

Abstract

Background: Clostridium perfringens causes necrotic enteritis (NE) and NetB is a critical pore-forming toxin in the development of this disease in chickens.

Objectives: The aim of this study was to evaluate the prevalence of C. perfringens in organic broiler farms and to assess the presence of netB gene among isolates and its occurrence with respect to NE disease.

Materials and Methods: A total of 103 intestinal samples (from eight farms clinically suspected to NE) were collected and evaluated by biochemical tests and polymerase chain reaction (PCR).

Results: Genotyping results showed the prevalence of 43.69% (n = 45) for C. perfringens. All isolates belonged to type A, and other toxinotypes of bacterium were not detected. Eight isolates (17.78%) from four farms were positive for netB gene. The present study represented the prevalence of the netB gene for the first time in organic broiler farms.

Conclusions: The results indicate that the role of netB in the induction of NE needs to be further investigated, to clarify the role of C. perfringens as commensal or pathogenic and to authorize a much better correlation between gene expression of netB toxin and the pathogenic capacity of C. perfringens strains from organic systems.


Keywords: Necrotic enteritis, PCR, NetB, Clostridium perfringen

 

Background

Clostridium perfringens (C. perfringens), a major enteric pathogen, can lead to both clinical and subclinical disease in broiler chickens.1 This bacterium was divided to five types (A, B, C, D and E) based on the presence of major toxins (α, β, ε and ι). It produced some important minor toxins such as enterotoxin, beta2, necrotic enteritis toxin B (NetB), TpeL and perfringolysin O (PFO).2C. perfringens is responsible for causing necrotic enteritis (NE) of poultry, especially by type A and rarely type C.3C. perfringens type A is the most frequently isolated clostridial type from NE cases.4,5

NE is an economically important disease with severe gastro-intestinal signs in commercial broiler farms and was reported for the first time by Parish.6 Two forms of NE were described: clinical and subclinical.7 Clinical NE, primarily in young chickens (between two to six weeks), is characterized by severe necrosis in the mucosa of proximal jejunum and associated with high mortality rates.8 Subclinical NE is led to a decreased performance (reduced growth, reduced feed efficiency) without mortality, due to the extensive mucosal damage.9

Keyburn et al discovered a pore forming toxin of C. perfringens which they named NetB and the encoding gene, netB and recognized this gene in C. perfringens isolates recovered from chickens. They showed the relationship between presence of netB gene and NE outbreaks and reported that NetB is critical to the development of NE, in chickens.10

To our knowledge, there were not published data about NE outbreaks and responsible toxins for causing this disease in organic broiler farms.

Objectives

This study was firstly aimed to genotype the pathogenic C. perfringens isolates in organic broiler farms and secondly to assess the presence of netB gene among them and its occurrence with respect to the disease NE.

Materials and Methods

Sampling

A total of 103 intestinal samples of broiler chickens, clinically suspected to NE, were obtained from eight organic farms. Samples were collected aseptically in plastic bags in the post-mortem examination of chickens and quickly transported to the laboratory in ice-cooled containers. The sampling farms were randomly selected. The analysis for bacteria isolation started as soon as samples arrived to the laboratory.

Lane M: VC 100bp DNA ladder (Vivantis, product No: NL1402); lanes 1 and 3-5: C. perfringens type A field isolates (negative for netB gene); lane 2: negative control (dH2O); lanes 6 and 7: C. perfringens type A field isolates (positive for netB gene).

Isolation and Biochemical Identification

Intestinal contents were processed according to a routine protocol as previously described by authors.11 The pure cultures of isolated C. perfringens were submitted to the following biochemical tests as described by MacFaddin12: lecithinase, lipase, gelatinase, motility and skim milk coagulation (stormy reaction). Furthermore, for confirmation of C. perfringens isolates, all strains were incubated in selective tryptose-sulfite cycloserine (TSC) agar (Merck, 1.11972), as shown black colonies. Isolates were stored in 25% glycerol at -80˚C for further analyses.

Reference Strains

Positive and negative controls were used for confirmation of C. perfringens isolates by multiplex polymerase chain reaction (PCR). The C. perfringens ATCC13124 and C. perfringens type B (CN228), type C (CN301) and type D (CN409) reference strains were used as positive controls as well as C. septicum (CN913) as negative control (Reference strains were obtained from the bacterial isolate archive of the Razi Institute of Iran). Also, distilled H2O was applied as a negative control to confirm the absence of contamination of material and facilities and removal of experimental errors and to prove the exclusion of non-target DNA.

DNA Extraction

Both, the isolated and reference strains were cultured in tubes with 10 mL thioglycolate broth and incubated anaerobically overnight at 37˚C. Then, bacterial cultures were centrifuged for 10 minutes at 7500 g and collected 10-20 mg of pellets in 1.5 mL microtubes. DNA was extracted using the protocol provided in the DNA extraction kit (DN8115C, Cinnagen, Iran).

Polymerase Chain Reaction Amplification and Assay

Molecular typing of C. perfringens isolates were performed by multiplex PCR, as described by authors.11 Specific primers (Sinaclon, Iran) were used for amplification of genes (Table 1). Also, all isolates were examined for the presence of the netB gene by a duplex PCR reaction as previously described.10 The PCR assay was performed using a thermal cycler (Bio-Rad, California, USA) with a total reaction volume of 50 μL with the following reagents: 5 μL of 10X PCR buffer, 2 μL of 50mM MgCl2, 250 µM of each deoxynucleotide triphosphate, 5 U of recombinant Taq DNA polymerase (TA7506C, Sinaclon, Iran), 0.25μM of each of the primers, 5 μL of template DNA and distilled water till 50 μL.

Table 1. Primers Used in Molecular Identification of Isolated Clostridium perfringens in This Study
Gene (Toxin) Primers Primers Sequence (5'–3') Amplicon Size (bp) Reference
cpa (α) CPA5L
CPA5R
AGTCTACGCTTGGGATGGAA
TTTCCTGGGTTGTCCATTTC
900 13
cpb (β) CPBL
CPBR
TCCTTTCTTGAGGGAGGATAAA
TGAACCTCCTATTTTGTATCCCA
611 13
etx (ɛ) CPETXL
CPETXR
TGGGAACTTCGATACAAGCA
TTAACTCATCTCCCATAACTGCAC
396 13
iap (ɩ) CPIL
CPIR
AAACGCATTAAAGCTCACACC
CTGCATAACCTGGAATGGCT
293 13
cpe (enterotoxin) CPEL
CPER
GGGGAACCCTCAGTAGTTTCA
ACCAGCTGGATTTGAGTTTAATG
506 13
netB (NetB) AKP78-F
AKP79-R
GCTGGTGCTGGAATAAATGC
TCGCCATTGAGTAGTTTCCC
384 10
Clostridium cluster I CI-F1
CI-R2
TACCHRAGGAGGAAGCCAC
GTTCTTCCTAATCTCTACGCAT
231 14

Ten microliters of PCR products were evaluated for expected amplicons by electrophoresis on 1.5% agarose gel. The 100 bp DNA ladder (NL1402, Vivantis, Malaysia) was used as molecular marker to indicate the size of amplicons. DNA safe stain (PR881603, Sinaclon, Iran) was used for detecting nucleic acid in agarose gels. It is as sensitive as ethidium bromide and can be used exactly the same way in agarose gel electrophoresis. The amplified bands were visualized and photographed under UV illumination.

Results

C. perfringens was isolated in 43.69% (n = 45) of 103 intestinal samples from all organic broiler farms and the rates of isolation ranged from 18.18% to 64.29% between different farms (Table 2). Multiplex PCR results showed that all isolates belonged to type A and non-enterotoxin producers, harbouring the alpha toxin gene (cpa). Other types of C. perfringens (B, C, D and E) were not detected (Figure 1). Duplex PCR for detection of netB gene was performed and eight isolates (17.78%) from four farms were positive for this gene (Figure 2).

Table 2. Genotyping Results of Clostridium perfringens in Different Organic Broiler Farms
Farms No. of Samples No. (%) of Samples Positive for cpa Gene No. (%) of Samples Positive for netB Gene
F1 11 2 (18.18) 0 (00.00)
F2 12 4 (33.33) 1 (08.33)
F3 13 7 (53.85) 2 (15.38)
F4 14 9 (64.29) 3 (21.43)
F5 13 6 (46.15) 0 (00.00)
F6 14 5 (35.71) 0 (00.00)
F7 13 5 (38.46) 0 (00.00)
F8 13 7 (53.85) 2 (15.38)
Total 103 45 (43.69) 8 (07.77)

Figure 1. Multiplex PCR Typing of C. perfringens Isolates With α (900 bp), β (611 bp), ε (396 bp), ι (293 bp), Enterotoxin (506 bp) and Clostridium Cluster (231bp) Primers.

Lane M: VC 100bp DNA ladder (Vivantis, product No: NL1402); lane 1: Clostridium perfringens type A reference strain (ATCC 13124); lane 2: C. perfringens type B reference strain (CN228); lane 3: C. perfringens type C reference strain (CN301); lane 4: C. perfringens type D reference strain (CN409); lanes 5-9: C. perfringens type A field isolates.

Figure 2 . Duplex PCR of C. perfringens Type A Isolates for Detection of netB Gene (384 bp).

Discussion

Herein, C. perfringens was recovered from all organic farms involvement NE. Forty-five isolates were genotyped by PCR and revealed that all isolates were positive for cpa gene and negative for cpb, etx, iap and cpe genes. This means that all C. perfringens isolates from organic broiler farms are type A. These results were similar as previous studies in nonorganic poultry farms.15-18

The presence of cpa gene is not always correlated with clinical NE and other toxins are effective in NE outbreaks. Enterotoxin producer strains of C. perfringens may be associated with food poisoning.19 In this study, none of the isolates were positive for the cpe gene. The absence of this gene is not surprising because this gene is rarely found in avian C. perfringens strains.20,21 This result in organic broiler farms was similar to previous studies in broiler chickens.17,18,22

NetB, is a crucial toxin in NE outbreaks and it has been suggested that this potent toxin could contribute to disease effects in field isolates.10,23 In current study, the netB gene was detected in eight out of 45 C. perfringens isolates (17.78%) by PCR. Previously studies showed that NetB is not essential to the development of NE in all cases.15,24 But, our results showed that NetB has significant effect on the incidence of NE and negates those studies. Further studies are suggested to evaluate the relationship between the presence of the netB gene that can be produced NetB toxin and the occurrence of NE in organic broiler farms.

In conclusion, C. perfringens isolates from organic broiler farms with NE outbreak were found to be similar to those found in conventional systems based on typing characterization. The netB gene was detected for the first time at a low incidence (7.77%) in chickens with NE in organic broiler farms. In addition, the present study highlights the need for more studies to clarify the role of C. perfringens as commensal or pathogenic and to authorize a much better correlation between gene expression of NetB toxin and the pathogenic capacity of C. perfringens strains from organic systems.

Acknowledgments

We are grateful Mr. Sadegh Afzali and Mr. Moslem Afzali for their helpful comments.

Authors Contributions

Mojtaba Alimolaei developed the original idea and the protocol, abstracted and analyzed data and wrote the manuscript. Majid Ezatkhah cooperated in the experiment and interpretation of data analysis. Neda Shahdadnejad performed sampling and preliminary experiments.

Conflict of Interest Disclosures

None.

Funding/Support

This research was supported by project 0-85-18-90010/5, and funded by the Razi Vaccine and Serum Research Institute (RVSRI), Iran.

References

  1. Sengupta N, Alam SI, Kumar RB, Singh L. Diversity and antibiotic susceptibility pattern of cultivable anaerobic bacteria from soil and sewage samples of India. Infect Genet Evol 2011;11(1):64-77. doi:10.1016/j.meegid.2010.10.009. [Crossref]
  2. Petit L, Gibert M, Popoff MR. Clostridium perfringens: toxinotype and genotype. Trends Microbiol 1999;7(3):104-10.
  3. Opengart K. Necrotic enteritis. In: Saif Y, Fadly AM, Glisson JR, McDougald LR, Nolan LK, Swayne DE, eds. Diseases of Poultry. 12th ed. Iowa , USA: Iowa State University Press; 2008:872-879.
  4. Olkowski A, Wojnarowicz C, Chirino-Trejo M, Laarveld B, Sawicki G. Sub-clinical necrotic enteritis in broiler chickens: novel etiological consideration based on ultra-structural and molecular changes in the intestinal tissue. Res Vet Sci 2008;85(3):543-553. doi:10.1016/j.rvsc.2008.02.007. [Crossref]
  5. Songer JG. Clostridial enteric diseases of domestic animals. Clin Microbiol Rev 1996;9(2):216-234.
  6. Parish WE. Necrotic enteritis in the fowl (Gallus gallus domesticus). I. Histopathology of the disease and isolation of a strain of Clostridium welchii. J Comp Pathol 1961;71:377-333.
  7. Kaldhusdal M, Hofshagen M. Barley inclusion and avoparcin supplementation in broiler diets. 2. Clinical, pathological, and bacteriological findings in a mild form of necrotic enteritis. Poult Sci 1992;71(7):1145-1153.
  8. Long J, Truscott R. Necrotic enteritis in broiler chickens. III. Reproduction of the disease. Can J Comp Med 1976;40(1):53-59.
  9. Lovland A, Kaldhusdal M. Severely impaired production performance in broiler flocks with high incidence of Clostridium perfringens-associated hepatitis. Avian Pathol 2001;30(1):73-81. doi:10.1080/03079450020023230. [Crossref]
  10. Keyburn AL, Boyce JD, Vaz P, et al. NetB, a new toxin that is associated with avian necrotic enteritis caused by Clostridium perfringens. PLoS Pathog 2008;4(2):e26. doi:10.1371/journal.ppat.0040026. [Crossref]
  11. Alimolaei M, Ezatkhah M, Bafti MS. Genetic and antigenic typing of Clostridium perfringens isolates from ostriches. Infect Genet Evol 2014;28:210-213. doi:10.1016/j.meegid.2014.09.034. [Crossref]
  12. MacFaddin J. Biochemical Tests for Identification of Medical Bacteria. Baltimore: Lippincott Williams & Wilkins; 2000.
  13. Baums CG, Schotte U, Amtsberg G, Goethe R. Diagnostic multiplex PCR for toxin genotyping of Clostridium perfringens isolates. Vet Microbiol 2004;100(1):11-16.
  14. Song Y, Liu C, Finegold SM. Real-time PCR quantitation of clostridia in feces of autistic children. Appl Environ Microbiol 2004;70(11):6459-6465. doi:10.1128/AEM.70.11.6459-6465.2004. [Crossref]
  15. Gholamiandekhordi AR, Ducatelle R, Heyndrickx M, Haesebrouck F, Van Immerseel F. Molecular and phenotypical characterization of Clostridium perfringens isolates from poultry flocks with different disease status. Vet Microbiol 2006;113(1):143-152. doi:10.1016/j.vetmic.2005.10.023. [Crossref]
  16. Drigo I, Agnoletti F, Bacchin C, et al. Toxin genotyping of Clostridium perfringens field strains isolated from healthy and diseased chickens. Italian J Animal Sci 2010;7(3):397-400.
  17. Heikinheimo A, Korkeala H. Multiplex PCR assay for toxinotyping Clostridium perfringens isolates obtained from Finnish broiler chickens. Lett Appl Microbiol 2005;40(6):407-411. doi:10.1111/j.1472-65X.2005.01702.x. [Crossref]
  18. Gharaibeh S, Al Rifai R, Al-Majali A. Molecular typing and antimicrobial susceptibility of Clostridium perfringens from broiler chickens. Anaerobe 2010;16(6):586-589. doi:10.1016/j.anaerobe.2010.10.004. [Crossref]
  19. Myers GS, Rasko DA, Cheung JK, et al. Skewed genomic variability in strains of the toxigenic bacterial pathogen, Clostridium perfringens. Genome Res 2006;16(8):1031-1040. doi:10.1101/gr.5238106. [Crossref]
  20. Crespo R, Fisher DJ, Shivaprasad H, Fernández-Miyakawa ME, Uzal FA. Toxinotypes of Clostridium perfringens isolated from sick and healthy avian species. J Vet Diagn Invest 2007;19(3):329-333.
  21. Gomes AdM, Lobato FCF, Martins NR, Assis RA. Genotyping Clostridium perfringens broiler chickens isolates by multiplex PCR products analyses. Ciência Rural 2008;38(7):1943-1947.
  22. Engström B, Fermer C, Lindberg A, Saarinen E, Båverud V, Gunnarsson A. Molecular typing of isolates of Clostridium perfringens from healthy and diseased poultry. Vet Microbiol 2003;94(3):225-235.
  23. Keyburn AL, Bannam TL, Moore RJ, Rood JI. NetB, a pore-forming toxin from necrotic enteritis strains of Clostridium perfringens. Toxins 2010;2(7):1913-1927. doi:10.3390/toxins2071913. [Crossref]
  24. Martin TG, Smyth JA. Prevalence of netB among some clinical isolates of Clostridium perfringens from animals in the United States. Vet Microbiol 2009;136(1):202-205. doi:10.1016/j.vetmic.2008.10.026. [Crossref]