Submitted: 05 Dec 2015
Revised: 18 Feb 2016
Accepted: 01 Mar 2016
First published online: 23 Apr 2016
EndNote EndNote

(Enw Format - Win & Mac)

BibTeX BibTeX

(Bib Format - Win & Mac)

Bookends Bookends

(Ris Format - Mac only)

EasyBib EasyBib

(Ris Format - Win & Mac)

Medlars Medlars

(Txt Format - Win & Mac)

Mendeley Web Mendeley Web
Mendeley Mendeley

(Ris Format - Win & Mac)

Papers Papers

(Ris Format - Win & Mac)

ProCite ProCite

(Ris Format - Win & Mac)

Reference Manager Reference Manager

(Ris Format - Win only)

Refworks Refworks

(Refworks Format - Win & Mac)

Zotero Zotero

(Ris Format - FireFox Plugin)

Abstract Page Views: 441
PDF Downloads: 367
Full Text Views: 241
Typing Toxigenic Clostridium perfringens Strains from the Ruminants of Yazd Province by Multiplex Polymerase Chain Reaction

Int J Enteric Pathog, 4(3), 2-35249; DOI:10.15171/ijep.2016.02

Original Article

Typing Toxigenic Clostridium perfringens Strains from the Ruminants of Yazd Province by Multiplex Polymerase Chain Reaction

Majid Ezatkhah, Mojtaba Alimolaei, Maryam Amini, Mehrdad Shamsaddini Bafti ,*

1 Molecular Microbiology Department, Kerman Branch, Razi Vaccine and Serum Research Institute, Agricultural Research, Education and Extension Organization (AREEO), Kerman, IR Iran

*Corresponding Author: Mehrdad Shamsaddini Bafti, Tel: +98-9133980638; Fax: +98-34 32233051; Email: m.shamsaddini@rvsri.ac.ir

Abstract

Background: Anaerobic bacterial infections, especially enterotoxemia, are common ruminant disorders.

Objectives: The purpose of this study was to identify the toxigenic isolates of Clostridium perfringens in the ruminants of Yazd province.

Materials and Methods: In total, 485 fecal and intestinal samples were obtained and analyzed for typing C. perfringens toxovars by multiplex polymerase chain reaction (PCR). Only 179 bacterial strains passed the biochemical tests and 87 C. perfringens strains were confirmed by multiplex PCR.

Results: Interestingly, the predominant C. perfringens toxovar was type A (89.7%), while type D (9.2%) was also identified as a pathogen in the ruminants of Yazd province.

Conclusions: Detection of toxigenic C. perfringens isolates with multiplex PCR was performed for the first time in this field. The multiplex PCR used in this study provides a useful and reliable tool for C. perfringens genotyping in routine veterinary diagnostics,a nd epidemiological studies of the prevalent types of C. perfringens in Iran are possible by this technique. Genotyping of C. perfringens is recommended before starting vaccination programs.


Keywords: Multiplex PCR, 16SrRNA, Clostridium perfringens, Ruminant, Yazd province

Background

Clostridium perfringens (C. perfringens) is a gram positive, sporulating bacterium that is extremely pathogenic and responsible for a wide spectrum of anaerobic diseases in animals and humans. This bacterium is widely spread in the soil and the gastrointestinal tract of animals and is classified into five toxinotypes (A, B, C, D, and E) based on the production of one or more of the four main toxins (α, β, ε, and ι)1 which are responsible for specific enterotoxemia in animals.2 Enterotoxaemia is one of the most widespread lethal diseases in ruminants. This disease is indicated when a high level of toxins produced in the gut contents may be absorbed into the general circulation.3,4

Typing C. perfringens strains is important, because different types of bacteria are associated with specific enteric diseases in animals.5 Traditional methods have some limitations for bacterium typing. Serum neutralization test, enzyme-linked immunosorbent assay (ELISA),

and polymerase chain reaction (PCR) have been previously used for the classification of C. perfringens,5 among which PCR is the best choice for typing and sub-typing. Various PCR protocols have been established for the typing of C. perfringens isolates.6

PCR has been applied in several studies and highlighted as a rapid and accurate method for the detection of low copy numbers of genes. This method is more accurate and faster than conventional methods.7

Objectives

To the best of our knowledge, there is a lack of data on the prevalence and typing of C. perfringens strains in Yazd ruminant farms. Therefore, we used PCR for typing toxigenic C. perfringens strains in this field.

Materials and Methods

Samples

In total, 485 fecal and intestinal samples were investigated from the following species: domestic sheep (n = 206), goat (n = 129), and cow (n = 150). Collection and preparation of the samples was performed as previously described by Alimolaei, et al.8 Bacterial strains were isolated from the samples and the isolated colonies were analyzed according to the shape, color, type of hemolysis, and gram staining smears as described by MacFaddin.9 Biochemical identification of the catalase negative colonies presenting C. perfringens characteristics was performed as described previously.8

Reference Strains

Standard C. perfringens reference strains (ATCC13124, CN228, CN301, and CN409) were utilized as positive C. perfringens type controls (types A, B, C and D, respectively) as well as C. septicum strain CN913 as the negative control.

Polymerase Chain Reaction Amplification and Assay

DNA extraction from the isolated and reference C. perfringens strains was performed as previously described by the authors.10C. perfringens typing was performed with the total reaction volume of 50 μL and the following reagents: 5 μL of the extracted DNA with 25 μL of ready-to-use PCR master mix (PR901638, Sinaclon, Iran), 1.25 μL (20 pmole/μL) of each primer, and dH2O to reach a volume of 50 μL.

For the PCR amplification of 16S rRNA gene and α, β, ε, and ι toxin genes, specific primers (Sinaclon, Iran) were used (Table 1). Amplicons were obtained with 35 cycles following an initial denaturating step at 95ºC for 5 minutes. Each cycle involved denaturation at 94ºC for 1 minute, annealing at 53ºC for 1 minute, synthesis at 72ºC for 90 seconds, and final extension step at 72ºC for 5 minutes.

Table 1 . Sequence of Specific Primers Used for C. perfringens Typing in This Study
Toxin Gene Primers Sequence (5’–3’) Amplicon Size (bp) Reference
- 16S rRNA AAAGATGGCATCATCATTCAAC
TACCGTCATTATCTTCCCCAAA
279 11
α cpa GCTAATGTTACTGCCGTTGA
CCTCTGATACATCGTGTAAG
324 5
β cpb GCGAATATGCTGAATCATCTA
GCAGGAACATTAGTATATCTTC
196 5
ɛ etx GCGGTGATATCCATCTATTC
CCACTTACTTGTCCTACTAAC
655 5
ɩ iap ACTACTCTCAGACAAGACAG
CTTTCCTTCTATTACTATACG
446 5

Amplicons were evaluated by electrophoresis on 1.7% agarose gel. The 100 bp DNA ladder (PR911653 and PR901644, Sinaclon, Iran) was used as the molecular marker to indicate the size of the amplicons. The amplified bands were visualized and photographed under UV illumination.

Results

Out of 485 investigated samples, 849 bacterial isolates were morphologically selected for microbiological examination. From these isolates, only 179 strains passed the biochemical tests and were examined by PCR. In this study, we isolated and confirmed 87 C. perfringens strains by multiplex PCR (Table 2). Seventy-eight strains were classified as type A (possessing cpa gene), one strain belonged to type C (possessing cpa and cpb genes), and eight strains belonged to type D (possessing cpa and etx genes) (Figure 1). Other types of C. perfringens (B and E) were not detected.

Figure 1 . Typing of C. perfringens Isolates From The Ruminants of Yazd Province With cpa (324 bp), cpb (196 bp), etx (655 bp), iap (446 bp), and 16S rRNA (279 bp) Gene Primers by Multiplex PCR. A: Multiplex PCR on reference strains. M: 100 bp DNA ladder (PR911653, Sinaclon, Iran); Lane A: C. perfringens type A reference strain (ATCC® 13124); Lane B: C. perfringens type B reference strain (CN228); Lane C: C. perfringens type C reference strain (CN301); Lane D: C. perfringens type D reference strain (CN409); Lane S: negative control, C. septicum reference strain (CN913). B: Multiplex PCR on isolated C. perfringens. Lane C: negative control, dH2O; Lanes A1-A4: C. perfringens type A field isolates; Lane C1: C. perfringens type C field isolates; Lanes D1-D3: C. perfringens type D field isolates; M: 100 bp DNA ladder (PR901644, Sinaclon, Iran)

Table 2 . Genotyping of C. perfringens Isolates From the Ruminants of Yazd Province
C. perfringens Type Positive Isolates
No. %
A 78 89.65
B - -
C 1 1.15
D 8 9.20
E - -
Total 87 100

Discussion

C. perfringens infection in ruminants and other species is generically called enterotoxemia,4 in which C. perfringens proliferates in large numbers and produces several toxins.12 These toxins are responsible for enterotoxaemia in almost all the ruminants.13 There are geographical differences in the prevalent types of the these bacteria and the type could be different depending on the animal species in the area.7

Toxigenic typing of C. perfringens isolates could be performed by different conventional and modern methods. Serum neutralization test and ELISA assay have been applied previously.14-16

PCR method for the typing of C. perfringens was developed by Daube et al,15 and has been used in different conditions by other researchers.5,7,8,10,13,17-22, The multiplex PCR presented here included all the important toxin genes in C. perfringens mediated enterotoxaemia.8,21 Compared to the conventional techniques, PCR method was shown to be much more rapid, provided results in a few hours, and was much more reliable.23

In the present study, typing of C. perfringens isolates by multiplex PCR revealed that types A and D were the most important types of C. perfringens in the ruminants of Yazd province. Type A was the most frequent type of the bacteria which was isolated from the environment and digestive tract of the animals and humans.1 Similar results were obtained by Greco et al,17 who reported that, while C. perfringens types A and D were detected at the rates of 84% and 16% by PCR, respectively, type A was reported as the dominant type of C. perfringens in lambs and sheep worldwide.7

In conclusion, the detection of toxigenic C. perfringens isolates circulating in the ruminant fields of Yazd province is very important and was performed for the first time in this field. In contrast to other protocols, in this study, the used multiplex PCR was specific for C. perfringens, since we applied a specific primer (16S rRNA) for the diagnosis of C. perfringens species. This multiplex PCR provided a useful and reliable tool for C. perfringens genotyping in veterinary diagnostics and the type A of C. perfringens was more than other types in small ruminants.

Acknowledgments

The authors wish to thank the staff of Razi Vaccine and Serum Research Institute, Kerman.

Authors Contributions

Mehrdad Shamsaddini Bafti and Majid Ezatkhah: study concept and design; Mojtaba Alimolaei and Maryam Amini: acquisition, analysis and interpretation of data; Mojtaba Alimolaei and Mehrdad Shamsaddini Bafti: drafting of the manuscript; Majid Ezatkhah and Maryam Amini: administrative, technical, and material support; Majid Ezatkhah and Mehrdad Shamsaddini Baft: study supervision.

Conflict of Interest Disclosures

None.

Funding/Support

This study was supported by a grant (No. 0-85-18-90010.5) from the Razi Vaccine and Serum Research Institute,

References

  1. Petit L, Gibert M, Popoff MR. Clostridium perfringens: toxinotype and genotype. Trends Microbiol 1999;7(3):104-110. doi: 10.1016/s0966-842x(98)01430-9. [Crossref]
  2. Gkiourtzidis K, Frey J, Bourtzi-Hatzopoulou E, Iliadis N, Sarris K. PCR detection and prevalence of α, β, β2, ε, ι and enterotoxin genes in Clostridium perfringens isolated from lambs with clostridial dysentery. Vet Microbiol 2001;82(1):39-43. doi: 10.1016/s0378-1135(01)00327-3. [Crossref]
  3. Sipos W, Fischer L, Schindler M, Schmoll F. Genotyping of Clostridium perfringens isolated from domestic and exotic ruminants and swine. J Vet Med B Infect Dis Vet Public Health 2003;50(7):360-362.
  4. Uzal FA, Songer JG. Diagnosis of Clostridium perfringens intestinal infections in sheep and goats. J Vet Diagn Invest 2008;20(3):253-265. doi: 10.1177/104063870802000301. [Crossref]
  5. van Asten AJ, Van Der Wiel CW, Nikolaou G, Houwers DJ, Gröne A. A multiplex PCR for toxin typing of Clostridium perfringens isolates. Vet Microbiol 2009;136(3-4):411-412.
  6. Settanni L, Corsetti A. The use of multiplex PCR to detect and differentiate food-and beverage-associated microorganisms: a review. J Microbiol Methods 2007;69(1):1-22. doi: 10.1016/j.mimet.2006.12.008. [Crossref]
  7. Yoo HS, Lee SU, Park KY, Park YH. Molecular typing and epidemiological survey of prevalence of Clostridium perfringens types by multiplex PCR. J Clin Microbiol 1997;35(1):228-232.
  8. Alimolaei M, Ezatkhah M, Shamsaddini Bafti M. Genetic and antigenic typing of Clostridium perfringens isolates from ostriches. Infect Genet Evol 2014;28:210-213. doi: 10.1016/j.meegid.2014.09.034. [Crossref]
  9. MacFaddin J. Biochemical Tests forIdentification of Medical Bacteria. 3rd ed. Baltimore: Lippincott Williams & Wilkins; 2000.
  10. Ezatkhah M, Alimolaei M, Shamsaddini Bafti M, Amini M. Biochemical and PCR detection of Clostridium perfringens genotypes from camels. Online Journal of Veterinary Research 2015;19(8):567-571.
  11. Wu J, Zhang W, Xie B, et al. Detection and toxin typing of Clostridium perfringens in formalin-fixed, paraffin-embedded tissue samples by PCR. J Clin Microbiol 2009;47(3):807-810. doi: 10.1128/JCM.01324-08. [Crossref]
  12. Uzal F. Diagnosis of Clostridium perfringens intestinal infections in sheep and goats. Anaerobe 2004;10(2):135-143. doi:10.1016/j.anaerobe.2003.08.005. [Crossref]
  13. Kalender H, Ertas H, Cetinkaya B, Muz A, Arslan N, Kilic A. Typing of isolates of Clostridium perfringens from healthy and diseased sheep by multiplex PCR. Vet Med 2005;50(10):439.
  14. Nagahama M, Kobayashi K, Ochi S, Sakurai J. Enzyme-linked immunosorbent assay for rapid detection of toxins from Clostridium perfringens. FEMS Microbiol Lett 1991;84(1):41-44. doi:10.1111/j.1574-6968.1991.tb04566.x. [Crossref]
  15. Naylor R, Martin P, Barker L. Detection of Clostridium perfringens α toxin by ELISA. Res Vet Sci 1997;63(1):101-102. doi:10.1016/S0034-5288(97)90168-5. [Crossref]
  16. Naylor R, Martin P, Sharpe R. Detection of Clostridium perfringens epsilon toxin by ELISA. Res Vet Sci 1987;42(2):255-256.
  17. Greco G, Madio A, Buonavoglia D, et al. Clostridium perfringens toxin-types in lambs and kids affected with gastroenteric pathologies in Italy. Vet J 2005;170(3):346-350.
  18. Hadimli HH, Erganis O, Sayin Z, Aras Z. Toxinotyping of Clostridium perfringens isolates by ELISA and PCR from lambs suspected of enterotoxemia. Turkish Journal of Veterinary and Animal Sciences 2012;36(4):409-415.
  19. Heikinheimo A, Korkeala H. Multiplex PCR assay for toxinotyping Clostridium perfringens isolates obtained from Finnish broiler chickens. Lett Appl Microbiol 2005;40(6):407-411. doi:10.1111/j.1472-765X.2005.01702.x. [Crossref]
  20. Ahsani M, Mohammad Abadi M, Shamsaddini Bafti M, Ezatkhah M, Hasani Derakhshan M, Esmailzadeh Koshkooeh A. Application of triplex PCR technique in identification of Clostridium perfringens B, C and D types. Quarterly Iranian Journal of Animal Science Research 2010;2(2):185-190.
  21. Ahsani M, Shamsaddini Bafti M, Esmailizadeh A, Mohammadabadi M. Genotyping of isolates of Clostridium perfringens from vaccinated and unvaccinated sheep. Small Rumin Res 2011;95(1):65-69. doi: 10.1016/j.smallrumres.2010.09.001. [Crossref]
  22. Ahsani M, Mohammadabadi M, Shamsaddini M. Clostridium perfringens isolate typing by multiplex PCR. J Venom Anim Toxins Incl Trop Dis 2010;16(4):573-578. JVATiTD 2010;16(4):573–8. doi: 10.1590/s1678-91992010000400006. [Crossref]
  23. Kadra B, Guillou J, Popoff M, Bourlioux P. Typing of sheep clinical isolates and identification of enterotoxigenic Clostridium perfringens strains by classical methods and by polymerase chain reaction (PCR). FEMS Immunol Med Microbiol 1999;24(3):259-266. doi: 10.1111/j.1574-695X.1999.tb01292.x. [Crossref]